User Tag List

Page 2 of 2 FirstFirst 12
Results 9 to 14 of 14

Thread: P. agnata (giant)

  1. #9
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $11
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  2. #10

    Join Date
    Mar 2005
    Location
    Chicago, IL
    Posts
    168
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $15

  3. #11
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    Bump.

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I sent out my prtion of this some time ago. Have not recieved word of arrival.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13

    Join Date
    Mar 2005
    Location
    Chicago, IL
    Posts
    168
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Both parts of this auction have safely arrived and are settling in to their new home quite nicely. Sorry for the delay in responding.

    Corey

  6. #14
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    t.c.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 2 of 2 FirstFirst 12

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •