User Tag List

Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Apx 40(leuco "red" x minor "okee")xleco ABG sepaloidSeeds (Winner schloaty - $7)

  1. #1
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)

    Apx 40(leuco "red" x minor "okee")xleco ABG sepaloidSeeds (Winner schloaty - $7)

    These seeds were donated by Pyro.

    Starting bid is $2

    Shipping is free.


    US only.
    Last edited by Ozzy; 06-07-2008 at 11:50 AM.

  2. #2
    rco911's Avatar
    Join Date
    Jul 2007
    Location
    3738'N 12229'W
    Posts
    372
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $3

  3. #3
    Two flies one pitcher. Minus the crap eating. obregon562's Avatar
    Join Date
    Aug 2007
    Location
    Lakewood, California, USA
    Posts
    1,253
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $5
    "It's easy to rip on cops, when you aren't the one needing saving"

    My Growlist

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thought people might like to see the parents so...

    Seed parent:



    Pollen parent is a leucophylla that has blooms similar to but larger than those of 'Tarnok' The plant itself, other than the flowers, looks like a typical leucophylla
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5

    Join Date
    Oct 2007
    Location
    New London, CT
    Posts
    3
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $6

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    $7
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    Seeds have been shipped.

  8. #8
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    This is a reminder to complete this auction. Either send payment or the item that was won. If the payment was sent and item received, please post here so this can be closed.

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •