User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Pinguicula research

  1. #1
    Pinguiphile
    Join Date
    Aug 2006
    Location
    Salinas, CA
    Posts
    25
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Greetings all,

    As part of my Horticulture education at Penn State University, I will be performing a study of pinguicula species and hybrid propagation via traditional and tissue culture methods on varying substrate(s) and substrate composition respectively. I plan the study as follows:

    (Look at my growlist to see the pings to be used in the study, I hope to use all, however this might not prove to be possible.)

    Leaf pullings will be placed in small propagation trays (actually chinese takeout containers but boy do they work well) on;

    Long fibered spaghnum
    Perlite
    Vermiculite
    peat
    possibly a combination of the above media though that is to be determined

    Any suggestions for other media to test?

    I will grow the parent pings and leaf pullings in a greenhouse under MH lights with cappilary matting for irrigation. (DW of course)

    Concurrently, leaves of all representative pings will be placed into tissue culture to compare efficacy of propagation as well as trueness to type(DNA analysis on propagules and parents to be performed.) Media recipe will be the same as reported by Adams, Koenigsberg, and Lanhans 1979, though I won't be doing the high salt treatment they performed since that will just mean dead pings as they showed.

    I hope to see that TC produces the highest number of plantlets, but also has a higher incidence of mutation. From there I hope to determine the optimal media for "traditional" propagation.

    I know that many members have their own methods for propagation and cultivation so if you would like to share methods, ideas, stories, conjectures or otherwise, I will be sure to acknowledge both your contribution as well as terraforums for providing this message board.

  2. #2
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I look forward to your results! Hey, how about using sponge filter as a medium or the the foam that computers are packed with?

  3. #3
    Hort. School dropout X 2
    Join Date
    Mar 2006
    Posts
    1,276
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sounds like a gr8 experiment.
    I have used Horticultural sand with mixed results, mainly because other people were watering (over or under).them.
    The sand does keep down the amount of moss taht so willingly grows on other media. Thanx for lsitenign and keep 'em plants growin'
    Lois
    Every seed that you plant ,doesn't sprout.
    Every seed that sprouts, doesn't make it to maturity.
    Every cutting that you stick doesn't grow roots.
    Every cutting that roots doesn't grow to a small plant.
    Every small plant doesn't reach maturity.


    Who needs speelcheck?

  4. #4
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What? Nobody has suggested coir (coconut fiber)? Come on you guys get with the program and have someone suggest coir.
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  5. #5

    Join Date
    Nov 2004
    Location
    Mount Dora
    Posts
    350
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How about rockwool.
    It's like walking out a door and discovering it's a window.

  6. #6
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    Um, use coir!

    Wonder why I suggested that.... ? ? ?
    \(_o)/ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  7. #7
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I will give you my input here. This post is just a placekeeper. I will update it with edits once I have a little more time to compose my response.
    Joseph Clemens
    Tucson, Arizona, U S A

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I use some pretty radical medias that might be good to try

    Crushed coral
    pine bark mulch (Natures Helper brand from Home Depot)
    orchid bark
    Rock wool cubes
    clay pellets
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •