User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 11

Thread: Community Pots of fascinating plants

  1. #1
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Following is a photo, just taken (20Dec06) of 5 - 2 inch (10 cm) community pots of (Pinguicula 'Sethos' x Pinguicula gypsicola). To me, these plants are just amazing. BTW, these are not seedlings, but propagations by leaf-pullings.

    Joseph Clemens
    Tucson, Arizona, U S A

  2. #2
    FarmerDave's Avatar
    Join Date
    Jul 2006
    Location
    Tallahassee, FL
    Posts
    1,355
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ooooohhhh

    I like that one!

  3. #3
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks. I like that they have that nice holiday color -- almost like candy.
    Joseph Clemens
    Tucson, Arizona, U S A

  4. #4
    FarmerDave's Avatar
    Join Date
    Jul 2006
    Location
    Tallahassee, FL
    Posts
    1,355
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yeah. I like how they glitter in the light like that

  5. #5
    Hort. School dropout X 2
    Join Date
    Mar 2006
    Posts
    1,276
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Joseph.
    you grow some of the most spetacular pings that i have ever seen.
    Lois
    Every seed that you plant ,doesn't sprout.
    Every seed that sprouts, doesn't make it to maturity.
    Every cutting that you stick doesn't grow roots.
    Every cutting that roots doesn't grow to a small plant.
    Every small plant doesn't reach maturity.


    Who needs speelcheck?

  6. #6
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Lois,
    I appreciate that. The core of my policy is laziness, and I work, "hard" to discover how truly lazy I can eventually be, I endeavor to learn what the plants need, to be at their best, then, I let the plants do their work of showing me what their genome/genotype is capable of. Sometimes it results in them showing me how they just won't grow as well as I'd like them to. But, most of the time I get living, insect-eating, eye-candy.

    They look even better when there is a sizeable group of the same type growing closely together.

    This link may help explain what I am talking about:
    Wikipedia - Phenotype



    Joseph Clemens
    Tucson, Arizona, U S A

  7. #7
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i love looking at your plants.......always worth checking out.....they must be having some effect on me aswell since my Pings are starting to out number everything but my Utrics
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah, Pings are insidious that way. I was never really into Pings and then I accepted the Yucca Do complex. And the rest is history...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •