User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: P. ehlersiae

  1. #1

    Join Date
    Jul 2001
    Location
    somewhere in NJ
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello,
    This is going to be my first butterwort. What are the growing conditions for this fellow? Anything else I should I know about this plant? (Thanks Sarracenia0.)




  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mexi-Ping so provide an open mix. Keep it a little drier when dormant. grows fast when happy and takes easy from cuttings. In good light it will turn bright pink
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro. That was good... *stunned*

    That was everything - even the fact that it turns pink... In two lines...

  4. #4
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pinguicula ehlersiae grows well for me in 100% sphagnum peat moss, in 2 inch rose pots, taller than wide. One plant grows to nearly fill the pot. I use close proximity to fluorescent lights to get the strong form and nice pink tint to the leaves. See photos:
    P. ehlersiae page
    Joseph Clemens
    Tucson, Arizona, U S A

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Pink?!?
    WoW!
    I gotta move mine close to the light!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Similar Threads

  1. Pinguicula ehlersiae X P. moranensis
    By guqin in forum Butterwort (Pinguicula)
    Replies: 8
    Last Post: 03-19-2008, 06:49 AM
  2. How to grow a FAT ehlersiae Ping
    By norns in forum Butterwort (Pinguicula)
    Replies: 7
    Last Post: 11-07-2007, 10:37 AM
  3. Pinguicula ehlersiae
    By Joseph Clemens in forum Butterwort (Pinguicula)
    Replies: 6
    Last Post: 04-11-2005, 10:30 AM
  4. P. ehlersiae help
    By cchang in forum Butterwort (Pinguicula)
    Replies: 4
    Last Post: 03-22-2004, 11:19 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •