User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: What is that smell?

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    First off let me preface this by saying I AM NOT CRAZY

    Now that I have that out of the way... Many times I have noticed a faint aroma while working around my Pings. This weekend I was doing some propogation work and when I lifted the dome of my Ping tray I was hit by it again and was finally able to place the odor; onion. So I was wondering if this is just my pnats or if anyone else has noticed that their Pings smell oniony
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Pyro

    Isn't saying I'm not Crazy and I am raising CPs kind of oxymoronic?

    But yes if I am growing pings in an enclosed space I pick up a odor that is like wild onions.

    Cheers

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Pyro,
    I only notice and odor when I'm working on the plants in my socks..... [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]



    Peeeeeee-yeewwwww! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pete,

    Growing CPs is defined as being eccentric not crazy [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] So that solve the problem of me being and oxidized moron

    Schloaty,

    But my shoes were on [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Tony Paroubek's Avatar
    Join Date
    Oct 2001
    Location
    Far Away NY
    Posts
    4,640
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I prefer OBSESSED

    thank ye very much!
    hehe
    T

    Btw.. I placed that citrusy smell with my Nepenthes faizaliana as coming from the pitchers after they are emptied of fluid and rinsed out... must be something from the glands inside.
    Is that a Nepenthes in your pocket or you just happy to see me?

  6. #6
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro - I don't know I always thought you had to be rich to be eccentric.

    Tony - I can agree with obsessed - obsession is one of those conditions that gets you locked up with all the other obsessed people.

    Think of it - here at PFT we are all obsessed - it is kind of like an on-line virtual psychiatric ward and Phil is Dr. Crane....


    cheers,

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well if you have to be rich then I guess I am not eccentric and I will have to settle with obsessed.

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Pyro,
    I think you can be eccentric if you're old, too. Rich just lets you claim eccentricity at a younger age. MHO.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Similar Threads

  1. Mmm, the smell of ...
    By rco911 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 17
    Last Post: 01-04-2008, 01:30 PM
  2. I Smell...
    By ChronoKiento in forum General Discussions
    Replies: 79
    Last Post: 01-10-2007, 06:28 PM
  3. Getting the smell of death out of your car
    By bugfreak in forum General Discussions
    Replies: 20
    Last Post: 05-29-2006, 10:01 PM
  4. I don't like the smell of this...
    By Sszvein in forum General Discussions
    Replies: 4
    Last Post: 08-20-2004, 02:23 PM
  5. pitcher smell
    By mindmaze128 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 4
    Last Post: 08-19-2002, 04:21 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •