User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 22

Thread: Do you grow P. 'Weser'?

  1. #9
    drosera guy
    Join Date
    Apr 2003
    Location
    Düsseldorf, Germany
    Posts
    310
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    But the cultivar is not only the parents but a specific selected clone as I remembered? So only plants reproduced from the selected plant are the cultivar. All other plants with the same parents are very similar, but not P. x Weser.

    Jan

  2. #10
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here is a quote from the CP cultivar registration authority, Jan Schlauer:
    Quote Originally Posted by [b
    Quote[/b] ]You would have to select a clone or a group of plants from this offspring that is characterized by unique features. It is not possible to register a hybrid formula as a cultivar name (as opposed to the possibility of legitimate usage of hybrid formulas for taxonomic names!). Cultivars must always be defined by their unique features, it is not possible to restrict these features just to their derivation or parentage. This is why it is important to describe these distinctive features carefully and to include in the description a standard picture showing these features.
    i.e. "it is not possible to restrict these features just to their derivation or parentage"
    Joseph Clemens
    Tucson, Arizona, U S A

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am currently growing a plant that is supposed to be the real Weser straight from Slack's plant. I also know of one other grower with this plant. Neither of us has floweered it yet so the real ID is yet to be determined however but as soon as I see anything from mine or hear from the other grower I'd be happy to let you all know
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    JanW,
    The image you posted earlier of Pinguicula 'Weser' seems to fits Slack's photographic standard and description for Pinguicula 'Sethos', "...many-rayed mouth like a white star...":


    This is Slack's photographic standard for Pinguicula 'Weser': as the description states, "...solitary white streak down the central lower lobe..."

    Pyro,
    Anxiously looking forward to seeing a plant that actually fits, Slack's description for Pinguicula 'Weser' besides the photo in a certain CP photo gallery.




    Joseph Clemens
    Tucson, Arizona, U S A

  5. #13
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Remember; if a plant is indistinguishable from the written description and photographic standard for a certain cultivar, it is that cultivar.

    If you were to include a genetic analysis in the cultivar written description, I would then assume you would then need to perform the same genetic analysis to positively identify any questionable plants.

    With my mere human abilities, I promise you that I could not, without technical aide determine the genome/genetic identify of anything, let alone certain plant cultivars, if they are otherwise indistinguishable from each other.
    Joseph Clemens
    Tucson, Arizona, U S A

  6. #14
    drosera guy
    Join Date
    Apr 2003
    Location
    Düsseldorf, Germany
    Posts
    310
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    OK

  7. #15
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    I too await your flower Pyro!!
    Thanks all, this helps alot... [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Joseph,

    While I can not guarantee that the plant is the true 'Weser' I do trust my source for it. It is possible he was given incorrect material but he has been looking for the real 'Weser' as well for some time and I do not believe he would keep the 'Weser' tag on it if he at all felt it was not.

    Time will tell.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •