User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: N. maxima hybrid

  1. #1
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a Nepenthes hybrid involving maxima and perhaps mixta and/or fusca. Whatever the parantage, it really is a nice, rapid grower. The pitchers have a nice, ruby red peristome that turns to a dark red/purple with age. The medium sized pitchers are heavily spotted with a purplish red, and looks quite a bit different than miranda. The one I'm offering has two growth points, one with lower pitchers, and another growth point over 3 feet long with upper pitchers. I am looking for a good sized miranda, or any Nepenthes with descent sized uppers, and some red in the uppers. PM me with offers if interested [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] .

    SEE PICS HERE- http://www.freewebs.com/sancarn/nxmaxima.htm

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pm'd you
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think that's an N x 'Gentle.'
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Trust me, it's not a gentle. Completely different, especially in the uppers.

  5. #5
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Similar to N. x Gentle but no not it.

  6. #6

    Join Date
    Aug 2004
    Location
    San Diego, Ca.
    Posts
    657
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ] or any Nepenthes with descent sized uppers, and some red in the uppers
    I have a nice N. ventrata here [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    really I also a N. coccinea that is beginning to make uppers. Nice red ones too [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    Hi. My name is Ron, and I am a nepaholic.

  7. #7
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Spare me [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img] ! I have plenty of ventrata. Darn thing is just running laps around my chamber now.

  8. #8

    Join Date
    Jul 2005
    Location
    Long Beach California
    Posts
    1,494
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Quote Originally Posted by [b
    Quote[/b] (lol @ Dec. 10 2005,9:19)]Darn thing is just running laps around my chamber now.
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]
    \"Nepenthes, the Devil's Cup\" - Santos
    Updated 5/27/06 Grow/Want List
    Updated 4/4/06 My Nepenthes Photo Album
    Feel free to call me @: (562)528-6223 - seriously!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •