User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Looking for S.purpurea ssp. venosa var. montana se

  1. #1

    Join Date
    Jul 2003
    Location
    Rome, Italy
    Posts
    11
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Hi all

    I'm looking some seeds of this particular Sarracenia...
    Can someone help?
    In italy isn't still in cultivation and this forum i thought is the most probably place where i can find it.
    Thanks in advance
    Giancarlo C. - Rome, Italy -

    www.carniplanta.com (just a photogallery at now)

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Pesiolino,

    First thing we need to find out is do you have the needed import paperwork?

    Also, we don't generally talk money on this forum, so please don't offer to pay for it.....The seeds trade offer is fine, though.

    Good luck on your search!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3

    Join Date
    Jul 2003
    Location
    Rome, Italy
    Posts
    11
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Schloaty
    The seeds exchange will be good for me too.
    I know that for import seeds from USA isn't needed any paperwork or certificate, isn't it?
    Giancarlo C. - Rome, Italy -

    www.carniplanta.com (just a photogallery at now)

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, you have to check on the Italian import rules.

    I used to know what the rules for seed import to the US were, but I foget now....and they've probably changed since I did it three years ago anyway.

    My point is to just make sure you & your potential trade partner have any documents you need before you trade. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Jul 2003
    Location
    Rome, Italy
    Posts
    11
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks again Schloaty..
    I'm sure that isn't needed any documents for import seeds, i asked to the appropiated autorities...
    But i think the most difficult is now find those rare seeds..
    Hei!...Nobody? ...Advices for find them in nurseries are also welcome!
    Thanks in advance [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    Giancarlo C. - Rome, Italy -

    www.carniplanta.com (just a photogallery at now)

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can not help in the seed department but I just want to caution you that since this form of the plant is protected it might fall under the same regulations as plants like S. oreophila and S. alabamensis. I do not know this for sure but you might want to check into it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Mar 2005
    Location
    Wisconsin
    Posts
    907
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If it is under protected status, any exportation from the US, seeds included is not legal.
    \"Anyway, no drug, not even alcohol, causes the fundamental ills of society. If we're looking for the source of our troubles, we shouldn't test people for drugs, we should test them for stupidity, ignorance, greed and love of power.\"
    --P. J. O'Rourke
    GL

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •