User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: Another Pyro giveaway

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Alright so here is the deal. First read everything here, if you don't play by the rules then you don't get a cutting.

    I was at a friend's place yesterday and he had a bunch of Nep vines that he was going to toss out so I asked for them. I have 8 cuttings from 4 different plants. The onlu catch is that I have no idea what species they are. All I can say for sure is that they are all highlanders.

    So here are the rules:

    1) I will list all available cuttings here

    2) Only 1 cutting per person

    3) Because speed is of the essence here I am doing this for priority postage only

    4) Post in this thread indicating which cutting you want. I will not accept an answer of "whichever" or "whatever" Give me a specific number.

    5) Do not PM me

    6) Once all 8 are taken then the offer is closed.

    7) I will contact the lucky 8 by PM to finalize

    Here is the list:

    Unknown #1 x4
    Unknown #2 x1
    Unknown #3 x1
    Unknown #6 X2

    ReadySetGo
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    throckmoron's Avatar
    Join Date
    Jul 2006
    Location
    Austin, TX USA
    Posts
    169
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would like Unknown #6, please! Thank you so much!

  3. #3

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Unknown #3 sounds good to me. Let me kno where to send postage if I make it?

  4. #4
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Good save Pyro!!! Thanks for the time and effort to do this! (No nep for me, can't grow highlanders... )
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  5. #5
    NECPS President Dave S.'s Avatar
    Join Date
    Jun 2003
    Location
    Northern MA
    Posts
    589
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Unknown #6, thanks.

  6. #6

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    unknown #2 please
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  7. #7
    kahnli's Avatar
    Join Date
    Dec 2004
    Location
    New Haven, CT
    Posts
    627
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Unknown #1 please.
    Sturgeon's Law:
    "Nothing is always absolutely so".

    http://terraforums.com/forums/showthread.php?t=102021

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What the heck! Unknown #1 for me would be great!

    Let me know if you would like to reimbursed for shipping.

    -Dave
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •