User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: N. thorelii x aristo pollen

  1. #1
    srduggins's Avatar
    Join Date
    Aug 2004
    Location
    so. cal.
    Posts
    668
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a male thorelii x aristolochioides in spike now. Pollen should be available in a week or two and last for a few weeks after that.


    I also have a male Holland Hybrid in spike.
    A day without Nepenthes is like a day without sunshine

    --steve

  2. #2
    Hort. School dropout X 2
    Join Date
    Mar 2006
    Posts
    1,276
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    [QUOTE]srduggins
    (I also have a male Holland Hybrid in spike.)
    This may be a stupid question but is there such a thing as a female Holland Hybrid. I haven't been in the hobby long enough to find out.
    Lois
    Every seed that you plant ,doesn't sprout.
    Every seed that sprouts, doesn't make it to maturity.
    Every cutting that you stick doesn't grow roots.
    Every cutting that roots doesn't grow to a small plant.
    Every small plant doesn't reach maturity.


    Who needs speelcheck?

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Steve,

    Do you know if this pollen is fertile? It's a hybrid, so just thought I'd check - I know you mentioned this in my campanulata thread, but I forgot to ask you there.....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    srduggins's Avatar
    Join Date
    Aug 2004
    Location
    so. cal.
    Posts
    668
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have heard of successful pollination with this hybrid, (but not this actual plant). This is the first bloom for me. My plant came from Jeremiah, so perhaps he knows more about its fertility.
    A day without Nepenthes is like a day without sunshine

    --steve

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    FWIW the cutting I got from Steve is also putting out a spike so I'll have a bit of pollen here in a bit too.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    srduggins's Avatar
    Join Date
    Aug 2004
    Location
    so. cal.
    Posts
    668
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Last call for thorelii x aristo pollen from me.

    Still to come:
    spectabilis x veitchii
    spathulata x spectabilis
    tobaica "Dark Red" - This will be a great parent!
    (northiana x veitchii) x Tiveyi
    A day without Nepenthes is like a day without sunshine

    --steve

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •