User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 21 of 21

Thread: S. 'Leah Wilkerson' seeds available for trade

  1. #17
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (seedjar @ Sep. 20 2006,2:51)]The thing about Punnett squares is that when you try to deal with more than one gene, you instantly get tables that can't be visualized (at least by most people.) A two-gene Punnett square is a hypercube, a uniformly-bounded four-dimensional figure. Every additional gene requires the addition of two new dimensions to the table, so by the time you reach four or five genes you're beyond the visualization capacity of even the most highly talented savants. You can condense the information into a two-dimensional chart, but it quickly becomes illegible or unmanageable. When you add in the fact that most genes are more than simply dominant or recessive, Punnett squares become quite impractical, if not more or less useless.
    ~Joe
    Having dine a breif stint in a C. elegans lab I have to disagree with you somewhat. 3, 4 and 5 gene Punnett squares are often utilized by worm geneticists because the joy of a hermaphroditic model is that you can pretty much figure out the gene frequency of the offspring. So if you have a GFP, left bend, twitching, roller and you know that she is heterozygous for all traits then you can work out the offspring frequency. And it really is not that complex... I did it in my head on more than one occasion and I am nowhere near savant level intelligence

    Now as for the seeds themselves, Tony is correct to say that you can not call them 'Leah Wilkerson' they should be described as 'Leah Wilkerson' F2 or better yet complex x moorei.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #18
    Let's positive thinking! seedjar's Avatar
    Join Date
    Dec 2004
    Location
    Olympia, Washington
    Posts
    4,064
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Well, I'm saying it's difficult to think about it with a one-to-one correspondance between possible parent's genes and dimensions on the table, the way a single-gene square does. When I did multi-gene Punnett squares, we wrote them as squares within squares within squares. It's possible to write them this way, but at four genes with two possible alleles you have 64 cells in your table, and it's not nearly as handy and lucid as the single-layer squares. To calculate and list the possibilities in your head isn't terribly difficult, but representing it in an elegant figure like a single-gene Punnett square is another matter. When I speak of savants, I'm referring to people who can imagine charts in six, eight or more dimensions; enumerating the possible combinations is a much simpler matter.
    ~Joe
    o//~ Livin' like a bug ain't easy / My old clothes don't seem to fit me /
    I got little tiny bug feet / I don't really know what bugs eat /
    Don't want no one steppin' on me / Now I'm sympathizin' with fleas /
    Livin' like a bug ain't easy / Livin' like a bug ain't easy... o//~

  3. #19
    bucky78's Avatar
    Join Date
    Jul 2005
    Location
    Tennessee
    Posts
    422
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I still have a couple of lots left, I would also like to have a few more D. Rotundifolia if anyone is interested in trading or you can pm me with any offers.
    I don't want EVERY Sarracenia, just everyone that I see!!
    Growlist/Wantlist Updated 2/23/12:http://terraforums.com/forums/showthread.php?t=103039

  4. #20
    Cardiac Nurse JB_OrchidGuy's Avatar
    Join Date
    Apr 2005
    Location
    SC
    Posts
    3,818
    Mentioned
    2 Post(s)
    Tagged
    0 Thread(s)
    Bucky I got your last PM, but all that was in it was a qupte from the PM I sent you. Care to resend it?
    JB
    Friend me on facebook with JB_orchidguy@yahoo.com.
    Growlist Updated 05/08/13

  5. #21
    bucky78's Avatar
    Join Date
    Jul 2005
    Location
    Tennessee
    Posts
    422
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    PM Resent!
    I don't want EVERY Sarracenia, just everyone that I see!!
    Growlist/Wantlist Updated 2/23/12:http://terraforums.com/forums/showthread.php?t=103039

Page 3 of 3 FirstFirst 123

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •