User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 6 of 8 FirstFirst ... 2345678 LastLast
Results 41 to 48 of 61

Thread: Nep seed for SASE giveaway

  1. #41
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Update: Have three sprouts!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #42
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    cyclopse

    Quote Originally Posted by schloaty View Post
    Update: Have three sprouts!
    Already? Wow... any secrets?
    -Joel from Southern California


  3. #43

    Join Date
    Sep 2005
    Posts
    6
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi, pm for trade.

  4. #44
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's not "already." I was involved at the very beginning, so I've had them for just over a month. Still rather quick, I guess.

    My "secret," if you will, is keeping them very warm.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #45

    Join Date
    Apr 2006
    Location
    KY.
    Posts
    48
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    I am sendign an SASE

    I am sending an SASE. Thanks.

    Frank Lyons

  6. #46
    MissMorbus's Avatar
    Join Date
    Mar 2007
    Location
    Shreveport, LA
    Posts
    60
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm sending a SASE today. Thanks!

    Lisa

  7. #47
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Alright, that calls it. MissMorbus is the last one.

    Hope everyone enjoys
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #48
    MissMorbus's Avatar
    Join Date
    Mar 2007
    Location
    Shreveport, LA
    Posts
    60
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow, thanks. I tried counting everyone in the thread, and I didn't think I was anywhere near the end. I think I need to practice my counting.

    I can't wait to get them.

Page 6 of 8 FirstFirst ... 2345678 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •