User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: Pyro's super spring spectacular trade off.

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Pyro's super spring spectacular trade off.

    Okay, here is the deal. I have a bunch of stuff to get rid of. Read the rule because I do not have time to hold hands on this one

    1) I am not in a mad frantic rush so you don't necessarily have to be either. This is not first come first served. Take your time, check you collections, get your ducks in a row and then contact me.

    2) Trades take priority over postage offers. Large trades take priority over small trades.

    3) I have a ton of wants which I will list below. I am looking for ADULT or WELL SIZED plants (i.e. I do not want 3 leaf/2cm Ping gigantea cuttings). I am also looking for quantity so if you have 5 of something and are willing to part with them then please offer all 5.

    4) Because the source of my material is also the destination of anything I will be getting in trade I am going to have to insist on equivalent value type trading. So please do not make offers like a single D. pygmaea for a N. rajah. We are all reasonably familiar with what these plants go for online. If you want something that noramlly sells for $20 then your offer should be in the $15-20 range. A possible exception here would be with terrestrial Utrics. If you have a 4" pot that is fully carpeted and are willing to offer it up (minus a plug to keep for yourself to restart the plant) then I may be willing to scale up its value somewhat.

    5) EMAIL me your offers please with the following subject line: "TAHBWG trade (insert your forum name here)". I am going to have my hands full with sorting this stuff so this makes it easier for me. My email address is asplundii@gmail.comnospam (just remove the nospam)

    6) Note that a majority of what I am offering is "fresh from flask" I can not break these flasks until I know I will be removing everything from them. As such quantities are estimates and may need to be revised when I actually open the flask. I have tried to error on the low side in my estimates.

    7) I will do my best to keep this updated but given I do not have internet access over the weekend I am certain that it will get fuzzy at times. Please be patient with me.



    So, with all that out of the way, here is what I have

    Fresh from flask

    N. bicalcarata (I have 1 tub left probably has 4-5 plants in it)
    N. albomarginata "Green" (found another tub, probably has 10 or so plants)

    This is what I am looking for

    Aldrovanda vesiculosa
    Dionaea muscipula (interesting morphs)
    Drosera rotundifolia
    Cephalotus follicularis
    Darlingtonia californica
    Drosera adelae
    Drosera aliciae
    Drosera brevifolia
    Drosera burmannii
    Drosera capensis narrow leaf
    Drosera capillaris
    Drosera capillaris long arm
    Drosera cistiflora
    Drosera collinsae
    Drosera dichotoma
    Drosera dichotoma red
    Drosera filiformis filiformis (typical and red)
    Drosera filiformis tracyi
    Drosera intermedia Cuban
    Drosera macrantha
    Drosera madagascariensis
    Drosera marston dragon
    Drosera multifida extrema
    Drosera nidiformis
    Drosera nitidula omissa
    Drosera nitidula x occidentalis
    Drosera nitidula x pulchella
    Drosera obovata ivans paddle
    Drosera occidentalis occidentalis
    Drosera peltata
    Drosera pygmaea
    Drosera schizandra
    Drosera scorpoides
    Drosera slackii
    Drosera spathulata
    Drosera spathulata frazer island
    Drosera trinervia
    Drosophyllum (seed or plant if you are local)
    Pinguicula Frasiers beauty
    Pinguicula george sergeant
    Pinguicula gigantea
    Pinguicula grandiflora
    Pinguicula john rizzi
    Pinguicula laueanna
    Pinguicula lusitanicum
    Pinguicula macroceras nortensis
    Pinguicula macrophylla
    Pinguicula moranensis
    Pinguicula moranensis A
    Pinguicula moranensis x emarginata
    Pinguicula moranensis x gypsicola
    Pinguicula pirouette
    Pinguicula sethos (The real one not the mass market bogus one)
    Utricularia bisquamata
    Utricularia calycifida Lavinia Whatley
    Utricularia calycifida Yog Sothoth
    Utricularia dichotoma
    Utricularia gibba
    Utricularia livida
    Utricularia pubescens
    Utricularia reniformis
    Utricularia sandersonii
    Genlisea lobata X violacea
    Pinguicula lutea
    Pinguicula planifolia
    Pinguicula caerulea
    Last edited by Pyro; 03-19-2007 at 04:27 AM. Reason: Updating available
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    quogue's Avatar
    Join Date
    Aug 2006
    Location
    Long Island, NY
    Posts
    773
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm interested in the Regia's,
    I could offer up:

    a grown adelae
    a baggie of gibba
    I think it's bisquamata I have, it's a weed I would like to be rid of, could probly fill up a couple of 4" pots for ya

    Whaddya think?

  3. #3
    FarmerDave's Avatar
    Join Date
    Jul 2006
    Location
    Tallahassee, FL
    Posts
    1,355
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Email Sent!!!!

  4. #4
    Always a newbie glider14's Avatar
    Join Date
    Oct 2005
    Location
    Louisville, Kentucky
    Posts
    3,956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    email sent
    Everything is explainable. The seemingly unexplainable is but a result of our insufficient knowledge.- Hans Brewer

  5. #5
    Let's positive thinking! seedjar's Avatar
    Join Date
    Dec 2004
    Location
    Olympia, Washington
    Posts
    4,064
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Emailed you, then realized I messed up the title and emailed you again, then realized I messed up the title again and gave up... hopefully your spam filter will take pity on me.
    ~Joe
    o//~ Livin' like a bug ain't easy / My old clothes don't seem to fit me /
    I got little tiny bug feet / I don't really know what bugs eat /
    Don't want no one steppin' on me / Now I'm sympathizin' with fleas /
    Livin' like a bug ain't easy / Livin' like a bug ain't easy... o//~

  6. #6
    Av8tor1's Avatar
    Join Date
    Jan 2007
    Posts
    4,811
    Mentioned
    6 Post(s)
    Tagged
    0 Thread(s)
    email sent

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    e-mailed
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quogue...Pyro asked for EMAILS. So I hope you emailed him with your offer. Make sure you follow his directions to make it go smoothly.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •