User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 6 FirstFirst 123456 LastLast
Results 33 to 40 of 42

Thread: Dead beat traders list updated.

  1. #33
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    2 parents, 2 addresses, 2 different states. Even if a 'little gremlin' snatches one letter I doubt it can hop a plane and catch the second one
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #34
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    2 parents, 2 addresses, 2 different states[/QUOTE]
    NICE!

    Man, I wish I could be there when the manure hits the fan! What a show! Who's selling tickets?.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #35

    Join Date
    Jan 2003
    Location
    Gilbert, AZ
    Posts
    86
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Looks like it came back to bite him in the butt.
    And though the Heavens and the Earth pass away.

  4. #36
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Her actually, as it was recently pointed out to me, Nethaniel, is a she.

    Any how, things are not so simple that we cna just stop new members from registering with free accounts... trust me, I am looking in to ways to make it harder for some people to sneak back in.

    but you know, in the same vein, we have actually allowed a couple of people to think they have snuck back in to see if they will modify their behavior and play nice, and it has worked out for the better a couple times.

    Demi Nethaniels case is different, thievery is a serious flaw in charachter, and is obviously a violation of the law, we can not, and will not ever let her be a part of this board again.
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  5. #37

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    are you sure he/she is a she? I thought he said he was a he in the chat room... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    what about a IP-Bann?

  6. #38
    BANNED
    Join Date
    May 2003
    Posts
    2
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darn it. If i cant say it there, I'll say it here. Ludwig, your money has been sent, and I would apreciate a modest apology for the nasty things you said about me once you recieve it. That goes for you too Ram! You take things too personally! I think it's aweful, all the judgements you made. Now I'm here to pass judgement on you all. It's rediculous how you just go and judge people without even communicating with them. It's sickening!

  7. #39
    BANNED
    Join Date
    May 2003
    Posts
    2
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And another thing. I understand your all thinking that I'm no good, but thats no excuse. It really just isnt right. Im gone, and may we all finally be at peace.

  8. #40
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (JUDGEMENT DAY @ May 13 2003,02:06)
    I think it's aweful, all the judgements you made. Now I'm here to pass judgement on you all. It's rediculous how you just go and judge people without even communicating with them. It's sickening![/QUOTE]
    But it's ok for you to commit mail fraud and steal people's money? Belive me the jugement about you is clear. I also belive it is appropriate to lock this to prevent a possible ugly situation from developing. Dont' come back either. [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img]

    Page 5 of 6 FirstFirst 123456 LastLast

    Similar Threads

    1. 3-Level Questionable/Deadbeat Traders List
      By Tony Paroubek in forum Carnivorous Plant Trading Post
      Replies: 3
      Last Post: 11-20-2015, 09:17 PM
    2. How to tell a dead beat trader
      By LenG444 in forum General Discussions
      Replies: 2
      Last Post: 09-02-2003, 11:38 PM

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •