User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 26

Thread: Polocies of the trading forum

  1. #17
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My Goodness! Say off line for a whole weekend, and see what you miss?
    Remember, there is always the ways things SHOULD be....and the way things actually ARE.

    You SHOULD be able to politely ask for free stuff because people SHOULD not abuse this. HOWEVER (there's always a however, right?), people DO abuse this rule, so it had to be changed. Just because you are respectful and patient about your request doens't mean that Joe Shmoe is. Unfortunately, to protect the forum against the Joe Shmoes, there has to be a "please don't ask for free stuff" rule.
    BCK is right. Someone WILL eventually offer what you want. Either save you pennies, or just wait. A little patience goes a long way. This IS a hobby of patience, after all! [img]http://www.**********.com/iB_html312/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #18
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think Scholaty makes the most lucid point here. The decision to restrict the 'I want free plants' style post comes more from the past abuses than the current issue. Bear in mind that not all of you have been here from the beginning and you have not seen everything that transpires (both openly and behind the scenes.) The Mods and Admin make the decisions for the greater good, and unfortunatly that does mean some toes might get stepped on. We don't like to do that but sometimes we must.

    Casper, I feel a need to address somethings you said:

    Quote Originally Posted by [b
    Quote[/b] ]As far as what you said about the locked thread, I must disagree. The thread was locked without good cause imo. Yes, there are rules, but maybe those rules arn't the best wishes of the community. This is a private forum, and the goal is to keep the buisiness interestes in mind for PFT, but lets face it, someone asking for a free nep hybrid is not hurting PFT's buisiness (unless they started selling hybrids very recently )
    You say the thread was "locked without good cause" but it is just your opinion. Just believing something does not make it so, I can be of the opinion that if I can just flap my arms hard enough I can fly but I'll learn the lesson the hard way if I throw myself off a parking deck to try and prove my opinion. Mods don't act on opinion, if something is done there is a good cause for it.

    I also do not like the implication that the Mods are not working for the best for the community. You are arguing that the thread should not have been deleted because it isn't your wish and you (want to) believe others agree. The reality is exactly like Phil said, whenever a post goes up that is essentially demanding free plants the Mods get bombarded with PMs asking that it be dealt with. So bearing that in mind, the wish of the community is that free plant requests not be posted and so the Mods were correct in their decision to delete the thread.

    Lastly, your final sentence is irrelevant to the debate at hand. It isn't about keeping business for PFT, it is about keeping the Trade Forum from being filled with 'Gimme Gimme', 'I want this now', 'Mine Mine Mine' and 'Fork it over' type posts. Now I am not saying that your post was one of those but if the rule was not in place then that is exactly what the Trade Forum would become. And I know this because the reason the rule was made in the first place is that there was a point when the first 2-3 pages of the trade forum where nothing but demands for free plants.

    I understand what you are saying. I really do. Tony does as well hence his post detailing right and wrong ways to ask about plants. But just because you don't like the rule doesn't mean that the rule is wrong or that the Mods are working against the wishes of the community.

    To draw a rather extreme example, as American citizens we are guaranteed the right to life, liberty and the pursute of happiness. However, that does not mean you can throw cinder blocks off of overpasses on to passing cars and then claim it is okay because that is what makes you happy.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #19

    Join Date
    Sep 2003
    Location
    N'awlins
    Posts
    313
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro:

    First off, I didn't make a request for free plants, I was just stating my opinion and belief on a topic that I had a view on.

    I said I didn't agree with the locking of a thread because I didn't see any harm in the discussion of the topic. The very same topic that has gone on for 2 pages, quite harmlessly if you ask me. Now, I am not screaming censorship or all the other nonsense that others have, and I do understand why he locked it. This is a forum. Forums are for people trading ideas and opinions.

    I surely don't recall making the implications that the Mods arn't working hard for this board, and if I did, I truly apologize. I know the mods work hard, and they take a lot of abuse, for basically, a thankless job. I salute all of you, but being a mod doesn't make you "right". I disagreed with something, and didn't see the harm in discussing it. As of now, I have a much better understanding of why the rule was implemented.

    So, at the end of the day, this thread hasn't caused any harm, and has given at least a few a better understandomg of a rule. No harm no foul if you ask me.

    To re-iterate what I said earlier, I never meant to imply that mods don't strive to make our community a better place, and if anyone got that message, than I apologize, it was never my intent. Your all a good bunch of people, and I know that you work to give us a better place to chat.


    Casper

  4. #20
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Casper,

    I am Pyro not Ozzy [img]http://www.**********.com/iB_html312/non-cgi/emoticons/tounge.gif[/img]

    Seems I mis-interpreted what you said:
    Quote Originally Posted by [b
    Quote[/b] ]Yes, there are rules, but maybe those rules arn't the best wishes of the community
    And I took that to mean that by enforcing the rules the Mods were not working for the community. Too much extrapolation on my part and I apologize
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #21
    cool85k5's Avatar
    Join Date
    Oct 2003
    Location
    Georgia U.S.A.
    Posts
    1,530
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a idea,lets make a begger forum,and when somebody demands/asks in a non polite way,put the post there.Kind of a blacklist for people that beg. [img]http://www.**********.com/iB_html312/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html312/non-cgi/emoticons/biggrin.gif[/img] Just kidding [img]http://www.**********.com/iB_html312/non-cgi/emoticons/tounge.gif[/img] But it just might work!


    Jerry

  6. #22
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]I have a idea,lets make a begger forum
    I donít think many of the good people hereís generosity would extend that far, cool85k5, even if it was tried


    [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img] lol its kinda funny tough. A beggers forum that blacklists people that beg [img]http://www.**********.com/iB_html312/non-cgi/emoticons/laugh.gif[/img]
    that makes no logic

  7. #23
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    ...my turn.
    I'd rather not see the beggar posts.
    Trade posts are nice to see if they are offering something I'd like, I'll check and see if I have extra of what is being looked for. I would not respond to a "Does any one have a (enter plant name) for free or sase?" Although a ""Does any one have a (enter plant name) for trade? I have a D. capensis plant to trade." and if I don't need the capensis but have what is being looked for I may contact that person privately and offer my plant for sase or free. (I have a few times already).
    But most of all. I'd rather post a "I have 20 portions of so so plant to go to the first 20 replies for sase." and give my stuff away that way. And these times are coming quick as my stock grows!
    I also like to watch who the givers are, and personally offer them my plants for sase or free. I think that is the number one reason you don't see me offer lots of give aways~yet~.
    [img]http://www.**********.com/iB_html312/non-cgi/emoticons/smile.gif[/img]
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  8. #24
    cool85k5's Avatar
    Join Date
    Oct 2003
    Location
    Georgia U.S.A.
    Posts
    1,530
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes,it was supposed to funny [img]http://www.**********.com/iB_html312/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html312/non-cgi/emoticons/biggrin.gif[/img]



    Jerry

Page 3 of 4 FirstFirst 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •