User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 22

Thread: Nep bical seed

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey all,

    I have a good number of Nep bical seed available. I am not demanding a trade but I am always looking to expand my collection so if you have anything please make an offer Worst I can say is "No thanks but send me an SASE and some are yours."

    I have not seperated them all out into packets yet but at a guess I'll have about 5-8.

    On your mark....


    Get set...

    Go!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Oct 2003
    Location
    Michigan
    Posts
    826
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would definitly like some for a SASE. PM Sent!
    BTW- where did you get those Seeds from?
    I thought you people where \"Plant Geeks\", Look at me Now...

    Growing List-
    http://www.**********.com/cgi-bin....t=17062

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    pmed ya!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Aug 2002
    Location
    Richmond Hill, Ontario, Canada
    Posts
    340
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sent you a PM...
    DOH!

  5. #5

    Join Date
    Sep 2003
    Location
    SoCal (born in utah)
    Posts
    1,140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow how did you get seed? did you have 2 flowering bicals?

  6. #6

    Join Date
    Dec 2003
    Location
    Pennsylvania
    Posts
    730
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    pmed you
    ~Brandon~ aka ~Carnivorkid~
    Member of SEPACPS
    My Growlist

  7. #7

    Join Date
    Dec 2003
    Location
    Pennsylvania
    Posts
    730
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I dont have any cp seeds to trade but would love to send a sase.
    ~Brandon~ aka ~Carnivorkid~
    Member of SEPACPS
    My Growlist

  8. #8

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would love some! I will PM you!

    SF

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •