User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Terrestrial utricularia

  1. #1

    Join Date
    May 2004
    Location
    Tempe, AZ
    Posts
    5
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hey everybody. i am looking for any terrestial utrics for large tropical planted vivaria. i have some suff to trade. ill also have some dart frogs i might trade for some cool utrics. p.m. me if u can work something with me. thank you much and have a wonderful day!!

    - david k

  2. #2
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    PM'd ya. also, Spec73 is one of the forum folk who is into dart frogs.

  3. #3

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Welcome to the forums and this eternal addiction, david! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Dart frogs? Aren't those supposed to be poisonous... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  4. #4

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Cool!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have PM'd you as well
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I also PM'd you a few days ago. Have you gotten what you wanted?
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  7. #7

    Join Date
    May 2004
    Location
    Tempe, AZ
    Posts
    5
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow! thank you everybody! im glad to be here and u all have made me feel quite welcome. yes, i am finding what i was looking for. i have dart frogs and do large tropical vivaria for them. i am working on doing one with utrics in it to add to the ecosystem and maybe controll some of the micro organisms in the tank. they would add a very beautiful look to the terraria. ill let you guys know how it turns out! take care.

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And naturally you'll post a pic when the vivarium is complete, yes?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •