User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 16

Thread: Another pyro giveaway

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have 10 packs of typical form D. filiformis to anyone willing to send an SASE.

    Same rules as all my giveaways apply. You post here and I will PM you my addy.

    After 10 replies the giveaway is over.

    ReadySetGo
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Jan 2004
    Posts
    20
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would like some ;p

  3. #3

    Join Date
    Apr 2004
    Location
    Kissimmee Florida
    Posts
    297
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would also be interested in a packet thanks.

  4. #4

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Also interested.. thanks [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  5. #5

    Join Date
    Jul 2004
    Location
    NY, New York
    Posts
    342
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Interested As well. thanks![img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  6. #6

    Join Date
    Apr 2003
    Location
    Tulsa, OK
    Posts
    166
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,
    I would like to try this one also. Envelope is in the mail today. Thanks.
    Rick Myers

  7. #7

    Join Date
    Oct 2003
    Location
    Michigan
    Posts
    826
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If no one claims them, I would happily take a pack, but keep me on the bottom of the list though since I am already growing like 20 of these guys... If I do get some they'll be for T/C experiments
    I thought you people where \"Plant Geeks\", Look at me Now...

    Growing List-
    http://www.**********.com/cgi-bin....t=17062

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Fygee, deleted your post as requested.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •