User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 16

Thread: Drosera regia "big easy"

  1. #1

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm hunting around for a d. regia "big easy". if you grow them, check my growlist out and we'll work out a trade. Post here, or PM me.

    Thanks everyone!
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  2. #2

    Join Date
    Jul 2004
    Location
    New York City
    Posts
    1,706
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    anyone?
    They say if you play a Microsoft CD backwards, you hear satanic messages. Thats nothing, cause if you play it forwards, it installs Windows.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Patience [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    HellzDungeon's Avatar
    Join Date
    Apr 2004
    Location
    NY
    Posts
    720
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    o, im sorry to cut myself into your post, but after someone trades with Am expert, i would love to make some sort of deal for D. Regia "Big easy", although i have to say, my plant collection is limited (to say the least -_-)
    Thanks so much, and i have to apologize 1 last time for barging in
    Hellz
    Nike SB is Bananas

  5. #5
    BobZ's Avatar
    Join Date
    Dec 2002
    Location
    Arcata, California
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The most direct way to obtain 'Big Easy' is to get it from the guy that developed and registered it. See
    http://www.drosera.com/regia/

  6. #6

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well i think it was create dby pinguiculaman, but im not sure if pingman has it to trade. i saw it at jeremiahs greenhouse the other day should be really cool to watch it develop
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  7. #7
    Juan-Carlos's Avatar
    Join Date
    Aug 2004
    Location
    Miami, Florida
    Posts
    304
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice plant! Wouldent mind one of them, Good luck amature expert!

    -Jc
    Heliamphora ... A genus that intrigues me and fills me with joy!

    -Jc
    Miami, Florida

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]well i think it was create dby pinguiculaman, but im not sure if pingman has it to trade. i saw it at jeremiahs greenhouse the other day should be really cool to watch it develop
    Kirk, the site Bobz listed is pingman's site.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •