User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: N. 'judith finn' cuttings, others for trade

  1. #1

    Join Date
    Mar 2005
    Location
    Midwest
    Posts
    15
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello, everyone! I'm a lurker-first time poster. I need to take some cuttings of my N. 'Judith Finn' soon, and I wanted to see if anyone was interested in a trade. In the past, I have potted up my cuttings and given them away to friends, but now all my friends already have this one. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]

    As most of you know, this is a highland hybrid that grows well under even lowland conditions--mine is in a terrarium, and does nicely. You can check a pic of the plant (about a year ago) here:

    I also have cuttings of the following to trade:

    Cissus amazonica
    Ficus pumila (creeping fig)--normal and curly forms
    Pilea sp. (red stem, small leaf)
    Fittonia "White Brocade"


    I am looking to trade for cuttings/rooted cuttings of:

    N. ampullaria
    N. bellii (formerly globomorpha, I believe)
    N. gracilis
    any other small pitchered, lowland-type Nepenthes[B]

  2. #2

    Join Date
    Sep 2004
    Location
    Zone 9
    Posts
    455
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Now, thats a gorgeous terrarium! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img] Whats your setup?

    Peter
    the cellist

  3. #3

    Join Date
    Mar 2005
    Location
    Midwest
    Posts
    15
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Rubra @ Mar. 11 2005,3:30)]Now, thats a gorgeous terrarium! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img] Whats your setup?

    Peter
    Thanks! It is a custom-made terrarium--wood/marine epoxy paint base with 3/8 inch tempered glass sides and sliding glass front. You can see how I put it together at Building a Terrarium The lights are 3 x 40 watt Compact Fluorescents. It also houses a small colony of poison dart frogs (blue--Dendrobates tinctorius 'New River') that are laying eggs in there.

    It uses a false bottom with a fountain pump to power the waterfall and keep the humidity up. I built a cabinet and faced everything with oak to make it acceptable to my wife to keep it in the living room.



    It's a little overgrown now (much more so than in the pic you see). . . I'm building 2 more 24" cubes out of epoxy-painted 1/4 inch ply and standard plate glass to expand my collection out into better growing conditions.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Holy Maceral! That terrarium is spectacular!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5

    Join Date
    Aug 2004
    Location
    NC
    Posts
    2,344
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    yeah it's awsome!
    what is that spikey thing near the top left corner?
    Talk sense to a fool and he calls you foolish-Euripides
    wikipedia rocks! (except for species info)(CPers-add your vast knowledge of CPs to wikipedia&#33
    A person is smart. People are dumb, panicky, dangerous animals and you know it
    Get all the fools on your side and you can be elected to anything

  6. #6
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    nice Ludisia

  7. #7

    Join Date
    Mar 2005
    Location
    Midwest
    Posts
    15
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (TheAlphaWolf @ Mar. 11 2005,8:43)]yeah it's awsome!
    what is that spikey thing near the top left corner?
    That spikey plant is Tillandsia ionatha. I believe it is a cultivar known as 'Druid.' It blushes red when in bloom, and I have some super tiny seedlings that are now 2+ years old . . . talk about slow growing!

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Did you get my PM? I was interested in a possible trade
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •