User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 6 FirstFirst 123456 LastLast
Results 9 to 16 of 44

Thread: Avian flu

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]I guess the only good news is health officials ARE taking this very seriously and are starting NOW to prepare although its not likely we will be anywhere close to prepared once it starts to spread to humans.
    Well, that and improved traffic patterns! Might not curse so much on my way to work in the morning....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    As a microbiologist I have this to say

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]


    Bear in mind where you are getting the majority of your information. The media. This is the same media that made SARS sound like it would be the next super plague. And West Nile (which, according to a number of reports, was not only supposed to be a major human problem but was supposed to wipe out more than half of the bird population in the US.) It is scaremongering and it is a great way to get people to watch the news and keep them around since they are bored to tears hearing about things in Iraq or Afganastan or where ever

    H5N1 avian infuenza has actually been around for the last 6 or 7 years so it is not a "new" thing. Cases have been popping up in the Far east for some time. Pretty much every health organization in the world has been following it and it really is not the beast the media is making it out to be.

    There has actually been no direct evidence that the people infected have aquired it from birds (circumstantial evidence in some cases has been that a sick or dead bird of some type might have been eaten. This is not direct evidence because there was nothing left of these eaten birds to test for the virus and hence Koch's postulate fails.) It has been a while since I read any primary literature on infuenza but when last I heard no one had actually proven that the strains that infect birds can infect humans (or vice versa) There has been a lot of hand waving and big talk but no real proof, i.e. isolating exactly the same strain from infected birds and infected people.

    In fact no one has shown that birds are even a reservoir for influenza and until a few years ago it was thought that pigs were the ones we caught the disease from!!

    Because of the loaction of the world where the outbreaks are occuring it has even been postulated, and it makes a bunch more sense to me, that mutant strains of the flu are occuring because of selective pressure in an over-populated community. And for those of you without immunology or epidemiology under your belts there is a huge correlation between highly populated areas and virulent disease occurance.

    I'll also toss in some tidbits you won't heard much on the news.

    -A detailed study was done (by NIH I think) and the outcome was that, while a pandemic might occur, the loss of life would more than likely not exceed 200 million world wide. Now 200 million is still a lot of people granted but remember that the world has 6.2 billion people in it.

    -In epidemiology there are really interestnig models of disease progression vs. lethality. A fast and lethal disease is less likely to spread because it burns up all its hosts in one area before it can jump to a new one (Ebola.) The flip side is that a slow lethal virus is stopped by quarantine measures (Anthrax.) A government bio-defence study actually concluded that there is no naturally occuring disease or manufactured biological weapon that could spread fast enough with a high enough mortality that it posed any type of risk to the U.S. The same can be said for most industrial countries.

    -There are anti-virals that work against influenza and there are large stocks of them available.

    -There seems to be a modest innate immunity to H5N1 in the human body. In a number of the cases in East Asia the family's of victims are also tested and in all the cases everyone in the family tests positive but showed no signs or symptoms of the disease. So of the 60 deaths there have actually been something like 300 or so cases. I would be willing to bet that a random sampling of the population would turn up a much larger number of people testing positive to the H5N1 strain.

    The long and short of it, at least for me is that I have never gotten a flu vaccine and I am not going to start now. And I am not going to worry about H5N1.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    im with Pyro on this one. its a slow news week, the hurricane issue is loosing steam so they are jumping on the flu issue like a pack of rabid dogs. look at West Nile Virus, it was also supposed to be one of those big bad bugs but it kind of fizzled out. turns out most who get infected dont get much more than a mild cold if that. there were very few cases in Montana this year and being that the whole state was wet all spring and the mosquitoes were so thick you darn near couldnt go outside we should have had a record number of cases. the average persons immune system is actually does what its supposed to do quite well. while i do believe "global epidemics" are possible and quite probable, they will never wipe out 1/2 the population.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #12

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (dlybrand @ Oct. 05 2005,10:34)]You never know. Halving the world population might resolve a lot of issues. If everyone is dying, things like class distinction and other prejudices might just completely dissapate. Or the chaos might make them a lot worse.

    -D. Lybrand
    Easy enough to say unless it where to happen to you or a friend of your`s [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_o_32.gif[/img]
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  5. #13

    Join Date
    Aug 2003
    Location
    Missouri,zone 5b
    Posts
    3,134
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Whew thats good to hear Pyro!

    I just hope they don`t go nuts and start destroying healthy populations of chickens just because there is the "chance" that they may become infected and destroy our flock if it does go stateside. Else I may just go nuts on them [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    [img]http://home.**********.com/users/pondboy/Neps/Neps%20sig..JPG[/img]

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (pond boy @ Oct. 06 2005,4:16)]I just hope they don`t go nuts and start destroying healthy populations of chickens just because there is the "chance" that they may become infected and destroy our flock if it does go stateside. Else I may just go nuts on them [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    You mean like they did a couple years ago when basically every game bird in China was slaughtered because of the panic?


    And, taken from today's PubMed postings

    - there are many different strains of H5N1. Most have low pathogenicity and are relatively harmless, and only some have proven to be deadly for birds and humans. Some species of waterfowl, like ducks and geese, are natural hosts of the H5N1 and do not fall ill from it. The virus has always been known to be virulent in commercial chickens, but they typically fall sick quickly and die within 24 hours of contracting it.

    -The country [Indonesia] has come under fire for reluctance to carry out mass culling of chickens in infected areas, like those conducted in some other countries.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My information came from a series of news reports on CNN over the past week or two.

    So...if all this is such a hullaballoo and has no real merit, wouldn't it end up making the reporters (CNN) look like fools for having cried "wolf!" over something that is no big deal? I mean they were interviewing all kinds of doctors, epidemiologists, CDC people, etc. and all agreed this was an impending serious health threat. They did also say they didn't know EXACTLY the "when"...only that this H5N1 was looking very likely to be THE pandemic they've been expecting.

    This particular strain has them worried because of the very close similarity to the Spanish flu strain.

    I hope you're right and its much a-do about nothing.

    hehe...I knew you'd have something to say about this...you microbiologist you. [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]



    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #16
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Got a few things to say.

    Be careful of what you hear from the media. That's all

    Do be weary of this oncoming flu, as it will be pretty darn bad.

    I don't advocate vaccines at all, as they often can do more harm than good in some cases. I deffinately wont be taking any faccines for this bird flue.

    I had a resperitory infection last year. For over a month, I was sick on and off, really bad, and there was no end to it in sight. That kind of thing can be fatal. The doc gave me antibiotics, but I was allergic, and didn't have insurance, so I could really only rely on my own knowledge of the body and nutrition, and prayer of course. All I really did was drink a lot of the super health drinks they sell here on the west coast, called "Naked" . Theese drinks have 1,000% vitamin C in each serving, and 2 servings per bottle. Crazy antioxidant power. I drank a couple of those, along with other naked drinks, and I was cured within a couple days. It never came back! Got sick a month ago too, and before it even got bad, I drank more of theese high nutrient drinks, and I barely got sick at all.

    You need to eat right, and have your body be clean from the inside out to avoid theese illnesses and diseases. It's the only way. Even says so in the bible. If the flu brakes out, all I'm gonna do is stock up on naked drinks, cacao beans, gojii berries, and avocados. Theese are some of the most nutitious foods in the world. Add strong prayer and meditation, and I have nothing to worry about.

Page 2 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •