User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 6 FirstFirst 123456 LastLast
Results 25 to 32 of 44

Thread: Avian flu

  1. #25
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I have a million and one things going on today but I will get back to all the comments here. Just letting you all know I'm not bugging out.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #26
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Okay, sorry it took soo long but work takes priority over everything else and I have not had enough free time to sit and answer all this until now.

    The stats I cite are not WHO because WHO only reports based on theior lab's results and kinda ignores everyone else. I got my info off my PubMed mailing list which is a daily email tracking worldwide emerging infections diseases and outbreaks. The stats there come from a variety of sources, WHO, CDC, local ministries of health etc. I also did a little background reading into flu in general and H5N1 in specific. More on that in a minute

    As for the media looking like fools, it won't be the first time and I seriously doubt it'll be the last. Like the media, the population at large seems to have a 5 minute attention span and we all tend to forget the idiotic things the media says. Like I cited before, there was insane hype over SARS and West Nile and BSE and none of those ever went past the hype stage but everyone seems to "forget" the media contributions to those collective circuses.

    Now, back to flu.

    Since 1918 there have been 3 other pandemics (not that the public ever hears about anything but the 1918 one.) In 1957 there was the H2N2 pandemic. IIRC there were ~20 million dead from that. It is also worth noting that after this flu took hold the H1N1 strain that had been around since 1918 basically disappeared. Then in 1968 there was the H3N2 pandemic. Death toll for this one was <10 million I believe and the reason they say it was not worse was because of cross protection to the N2 antigen. Like before, the H2N2 strain disappeared. Lastly, in 1977 H1N1 came back and for the last 28 years it and H3N2 have been the source for all the flu we have had.

    Now a breif genetics lesson. Flu naturally mutates. As an RNA virus it dose this a lot (the replication mechanism for RNA does not proofread like DNA replication so mutation rate is 1 per 100-1000 bases.) When a mutatin occurs in the H or N component of flu it can alter the infectivity/virulence. This is known as genetic drift. Genetic drift is the reason we have a "new" flu every year, a mutation occurs and the immunity you had to last years flu does not work for this years flu. Flu viruses are also capable of "swapping" whole genes (though the host for this is unknown.) In a case like this the H and/or N gene is swapped out for a totally new one. This occurance is known as genetic shift.

    So in summary, yearly flu outbreaks are caused by drift and pandemics are caused by shifts.

    With H5N1 we are looking at a genetic shift (remember there are wildtype H1N1 flu out there). Because of the nature of this shift (only the H component) there is every likelihood that there will be cross protection against the N1 component because for the last 28 years we have all been exposed to the N1 component in various forms from typical flu infections. And if you are a habitual flu vaccine person you are getting exposure too because the vaccine is built on the H1N1 strain for that year.

    Now just a few other nuggets to mull over.

    H5N1 has actually been around since 1997. There were outbreaks that year through 2000 and then it went silent again until 2003 (though there is one contended case in 2002.)

    The numbers most often tossed around for the 1918 flu are always the highest ones because they add to the shock value (hooray for the media!! ) The calcualted range was between 20 and 100 million and it was more likely that it was toward the 20 million as being directly caused by the flu. It has been discussed that more than half of the quoted cases were probably due to some type of secondary infection (pneumonia, bronchitis, sepsis, etc.) And you also have to remember that there was a war going on so there were likely a number of casualties that got mis-reported both on and off the battle field.

    This past summer WHO held a conference on H5N1 about what needs to be done. One of their major points was that NO sero-prevelance studies have been done and that that should be a top priority. For those of you not familiar with the word, sero-prevelance means people who test positive for exposure to the virus but have never displayed clinical signs or have only had "typical" flu and so no need to go to the hospital. As of the end of October the sero-prevelance studies have still not begun.

    Canada DOH, on a whim, decided to test some local birds (non-migratory.) And lo and behold they found H5N1. This tells us that H5N1 is probably already a "global" virus and probably has been for some time. I'd be willing to bet $5 that I could get the H5N1 virus out of the geese in my back yard lake. This is not some new freak virus that is coming out of the blue.

    There is a method to rapidly create a vaccine against any new strain of flu. The sick irony of it all is that it is a genetic method that would basically do in the lab what genetic drift accomplishes in the wild (this same method can be modified to handle a genetic shift) and provides a cleaner end product and a higher response curve, plus no nasty reactivation of virus effect that the current vaccine can cause. Now because of the "genetic engieneering" aspect of it, the cause heads have managed to convince the public to convince the government that this method is "dangerous" and "wrong" and "against nature" and all that garbage. And now it is those same cause heads convincing the public that the scientists are all worthless because they can not make a vaccine fast enough. Remeber, a little information is a dangerous thing. You can not have it both ways, you can either let us work or you can shut us down but don't get ticked at us when your collective butts are in the fire through something you yourselves brought about. You made your bed, you lay in it. One word here ladies and gentlemen: MORONS!

    I was glad to hear that Bush had released the restrictions against this method and would allow us to get vaccines faster and more efficiently and not have to rely on chicken egg purified extracts (Ewwww! ) Unfortunaly with FDA restrictions in place (not something I argue against) it will still take 3 years or so to get it cleared for humans so it won't stop H5N1 any time soon. Of course if the governemt had actually listened to the scientists (who know what they are talking about) rather than the general public (who more often than not get their information from the under informed talking heads) then we would not be in this little predicament. But you can not change the past, all you can do is hope that people will learn from their mistakes.

    Iknow there were other things I wanted to say but for the life of me I can not remember them. Maybe later.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #27
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It's all stupid. Just stupid. Knowledge is a powerful thing, and can be dangerous. But for those who actualy try to follow god's law, I find there is little detriment. Certainly can't say that about the politicians and government. I said it before, and I'll say it again. I wont be taking a vaccine that isn't for this strain, and I wont be taking the vaccine for this strain when it does come out. A good knowledge of health, meditation/prayer, and perhaps some electro therapy will get the job done. There is nothing to make us think that as apposed to5 years ago, this strain will now jump to humans. Could jump at any time, but not anytime soon. Notice how the stupid media has cut back on there little bird flue scare stories? Got one quote for these people and their poultry flue

    "If your vodka and cranberry is really dark like BlOOOOD, that's because it's not vodka buddy! And that's why it's only $3 a glass!"

  4. #28

    Join Date
    Jan 2003
    Posts
    140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro et al.,
    One thing that is scary is that the entire genome for the
    poliovirus and Spanish Flu (1918) have been described in their
    entirety in Scientific journals. (Possessing even fragments of 1918 Flu are now considered to be Select Agents)
    The poliovirus has been synthetically replicated in laboratories from the template and it is infectious.
    Terrorists could synthesize their own pathogens.

    Think about it...

    Kirk
    Fitchburg, MA

    P.S. So far the Avian Flu has not been shown to transmit person to person. Could happen though..

    P.P.S. The listserv that Pyro mentioned Pro-med is an excellent resource sponsored by Harvard University. Check the CDC Journal of Emerging Infectious Diseases too It's in electronic format.

  5. #29

    Join Date
    Jan 2003
    Posts
    140
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Pyro,

    Saw your notice about the Canadian migratory ducks.
    I believe that they have only been confirmed for H5 and are
    awaiting further confirmatory testing for the second N1 assay
    (See below).
    AVIAN INFLUENZA - WORLDWIDE (03): FAO UPDATE
    ***************************************
    A ProMED-mail post
    <http://www.promedmail.org>
    ProMED-mail is a program of the
    International Society for Infectious Diseases
    <http://www.isid.org>
    Other strains/strain not yet confirmed:
    - ---------------
    Germany (as of 25 Oct 2005)
    - ---------------------
    On 24 Oct 2005, a total of 25 geese and ducks were found dead at a
    lake popular for migratory birds in Rhineland-Palatinate State. The
    preliminary test on a wild goose was positive for influenza A.

    Canada (as of 31 Oct 2005)
    - ---------------------
    A survey of 4800 wild migratory ducks conducted during last summer
    [2004] found evidence of H5 in 28 migratory ducks in Quebec Province
    and 5 in Manitoba Province.

    Japan as of (2 Nov 2005)
    - ---------------------
    On 31 Oct 2005, antibodies to AI virus were detected in chickens by
    AGID and HI tests at an open-type farm with 82 046 chickens in
    Ibaraki prefecture, within the quarantined area of a previous
    outbreak in August 2005. No virus was isolated. All the birds at the
    farm have been culled. AI infection was also reported on the same day
    in a duck farm in Osaka Prefecture. AI H4 strain was diagnosed.

    Other AI viruses (non-HPAI-H5N1) were reported in Sweden (LPAI H5),
    Columbia (LPAI H9) and Iraq (in Erbil, H9).

  6. #30
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So, if this is not a big deal, then why are all the world's health organizations so concerned over it? I know its all just "possibilities" at this point (since it hasn't mutated to human to human transmission). Granted "the media" is giving it a lot of airplay but what they are reporting isn't staged actors...I've seen world conferences and heads of various medical/scientific groups discussing it. Bush has already set aside several billion dollars for future use for this issue.

    I'm not in any panic over it but it just seems strange so many people would be in such a tizz over something that isn't really a big deal.

    I am hoping it IS a lot of hype over nothing. It would be horrible if the dire predictions came true. All flus pose a threat to the general population but this seems to have caused more concern than normal.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #31
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This virus might be like a Magnitude 6 earthquake in California. It causes some damage and gets some mention in the news, but it isn't the Big One. It should motivate us to prepare for what's coming someday; not reassure us that there's little to worry about. Our public health system has been so crippled ... oops ... pardon my liberal leanings, I meant to say it's been made so efficient that we can't hope to handle even modest increases in emergency room visits and acute care.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  8. #32

    Join Date
    Mar 2005
    Location
    Evanston, IL
    Posts
    836
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Not to minimise the threat H5:N1 could cause, but it has killed 60 people. The regular old flu will kill 30,000 people in the US this flu season. But I do agree that it is something to keep an eye on.
    \"People place their hand on the Bible and swear to uphold the Constitution; they don&#39;t put their hand on the Constitution and swear to uphold the Bible,\" Jamie Raskin, to Senator Nancy Jacobs.

Page 4 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •