User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 6 FirstFirst 123456 LastLast
Results 33 to 40 of 44

Thread: Avian flu

  1. #33
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    remember its not the current H5:N1 thats a big threat to human life. its what it could mutate into
    that makes no logic

  2. #34
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LOL,

    I am not saying everyone need so get a vaccine. I have never gotten the vaccine because I too believe in good health and all that jazz and if I do get the flu then I cough and I sneeze and I have one more immunity to my bodies list. All I was pointing out was that the same people who shut down the best, fastest way to get an effective pandemic flu vaccine are now saying that the scientists are worthless because there is not a vaccine. Double standard hypocracy IMHO.

    Kirk,

    More than just the polio and Spanish flu have been full sequenced. There is a full sequence for anthrax and both of its toxin plasmids, for flesh eating strep, VREF, VRSA.. The list goes on and on. And while it is possible to "build from scratch" any bug that is published it would have to take place in a lab using equipment that your average terrorist just can not get, not even black market. And I know it sounds trite but terrorists like to do things the "easy" way which is why, even after 30 odd years, they number on thing they use is stuff like plastic explosives and such. Any monkey with a low 2 digit IQ can carry a home made bomb around that was made by another monkey with a slightly higher 2 digit IQ. Genetics takes at least 3 digits and I really don't think many terrorists qualify in that regaurd

    And thanks for the correction. It is indeed ProMed and not PubMed. What can I say, Mondays [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Also, not on ProMedbut on another EID list I follow Canada DOH has confirmed N1 but since WHO has not confirmed it in a WHO lab as well then CDOH is not allowed to "officially" say it is H5N1. Bureaucracy at its finest.

    PAK,

    World health organizations still concerned about AIDS and syphillus and gonorrhea and VREF and VRSA and anthrax and Ebolaand a whole slew of others but you never hear about it. Heck, they have been concerned about just run of the mill flu every year. But all those things are pish-posh and "old news" the general public does not care a whip. When was the last time you really heard some every day person express concern over contracting AIDS?? AIDS is to my generation what gonorrhea was to my parents generation and syphillus was to my grandparents generation. They are all something that only "dirty" "filthy" people get and then they just go to the free clininc for a shot and it is all better. WRONG!! Diseases don't just go away because the public loses interest in them and scientist don't just quit studying specific diseases just because the media gets done hyping them.

    Herenor,

    I agree with you in so many ways

    April and Finch,

    Yes and maybe. I believe that all diseases need to be watched and paid attention to. Bird flu is just this years hype. Could it go BOOM! Maybe, but then so could so many other things. How many people have heard about VREF?? This will probably kill more than 2 million Americans in the next 5 years but since they will likely be "just the elderly and the immunocompromised" then it is not news worthy enough. 2 MILLION PEOPLE IS NOT NEWS WORTHY!! Or how about this, how many of you knew that last week was supposed to be the announcment of the world wide erradication of polio?? Any one know why the announcment got canceled? I do. Or, and this is a really good one, does anyone know the name of the last person to contract wild smallpox? and do you know what he did when he learned that smallpox is probably not under the lock and key we the public had been led to believe it was.

    The sad fact is that diseases mutate and evolve and we have to evolve right along with them. That is what immunity is all about. And in our hyper clean, triclosan nation our immunity is crippled. There are 10 commensial bacteria for every 1 cell in/on your body. We are not ment to be sterile creatures.

    End of rant
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #35
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro is right. Every year my son is on the HIGH RISk list. Due to his disorders and diseases that he lives with everyday he is high risk. I did not like hearing about the newish flu, but I did know of its existance for years. I get my son the flu shot and pray he does not get very sick. He does off and on, but you learn to live with it. You can not let the media get to you. They make money off of hype. "Tell you about a plan crash with a smile on her face" Live life well. Get the most out of every day and everyone that you love. Pryo is the expert of this forum when it comes to this stuff. I am listening to him and I am not going to worry (any more than usual).
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  4. #36

    Join Date
    Mar 2005
    Location
    Evanston, IL
    Posts
    836
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Avian flu is already here. there are cases of it every year in North America. It's just not the H5:N1...I can't see worrying about anything you have absolutely no power over, at this point.

    There's a disease, a bullet, a car, a truck, a virus, or old age, a natural disaster out there with my name on it. I guess a person could make themselves crazy worrying about it...
    \"People place their hand on the Bible and swear to uphold the Constitution; they don't put their hand on the Constitution and swear to uphold the Bible,\" Jamie Raskin, to Senator Nancy Jacobs.

  5. #37
    BANNED
    Join Date
    Feb 2004
    Posts
    883
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'd rather worry about Dr. Turi's prediction for the end of the month. Big event coming around the 29th, and it won't be pretty [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img].

  6. #38
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Large dead birds will appear in houses all around the US.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  7. #39
    Let's positive thinking! seedjar's Avatar
    Join Date
    Dec 2004
    Location
    Olympia, Washington
    Posts
    4,064
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I get sick all the time, and somehow this whole avian flu thing doesn't really bother me. Maybe it's because I've read about too many other gross diseases like hemorrhagic fevers and meningitis and rabies. There's a lot of scary stuff out there and there always will be - it's an unavoidable consequence of being the planet's dominant species and constantly traveling and sending goods between populations. That's just the ecology of infectious disease.
    What I find scary is how everyone on the news calls it the 'avian bird flu.' It's somehow become ingrained into people's speech - I even caught my biology major friend say 'avian bird flu' despite the fact that he knows just as well as I that avian means bird. It's a sign of the times.
    ~Joe
    o//~ Livin' like a bug ain't easy / My old clothes don't seem to fit me /
    I got little tiny bug feet / I don't really know what bugs eat /
    Don't want no one steppin' on me / Now I'm sympathizin' with fleas /
    Livin' like a bug ain't easy / Livin' like a bug ain't easy... o//~

  8. #40
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (seedjar @ Nov. 09 2005,2:34)]It's a sign of the times.
    What? Stupidity?? [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]

    Quote Originally Posted by [b
    Quote[/b] ]Pryo is the expert of this forum when it comes to this stuff.
    I am not an expert (though I appreciate the thought behind being called that.) I am just someone in the field so I do know a bit more than the average person. I get all my info from primary literature and any one else can get it there too. It is easier for me since I have unhindered access through the university but for anyone really interested there are always libraries, a very under used source in this internet age.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 5 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •