User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 23

Thread: Glow in the dark pigs

  1. #9

    Join Date
    Jan 2005
    Location
    north carolina
    Posts
    805
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Maybe they can do the same thing with cp. Glow in the dark cp would be really neat. Don't let jimscott see this topic, or he will start experimenting on his plants trying to make them glow in the dark. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    John 3:16
    My grow list/want list
    Prior to the funeral home visit, we heard ~ "Hey'all watch this ! !"

  2. #10

    Join Date
    Mar 2005
    Location
    Wisconsin
    Posts
    907
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (PlantAKiss @ Jan. 17 2006,1:50)]So... were the pigs genetically engineered so that they would fluoresce? How does one make something fluoresce that doesn't normally? Can you make a human fluoresce?

    I have fluorescent minerals...they are awsome.
    PAK, the article said they inject jelly fish DNA into pig embroys. And if it works on pigs it will most likely work on humans, the DNA of both is fairly similar.

    There are pigs, in england if I remember correctly, that have 100% human blood pumping through them. Also I think they use pigs to try and make human livers, think it was livers.

    Quote Originally Posted by [b
    Quote[/b] ]Maybe they can do the same thing with cp. Glow in the dark cp would be really neat. Don't let jimscott see this topic, or he will start experimenting on his plants trying to make them glow in the dark. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    Yeah, that would help him find them when they float down stream, a nice canoe trip at night..
    \"Anyway, no drug, not even alcohol, causes the fundamental ills of society. If we're looking for the source of our troubles, we shouldn't test people for drugs, we should test them for stupidity, ignorance, greed and love of power.\"
    --P. J. O'Rourke
    GL

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    PAK, the GFP protein is one of the most ubiquitously used proteins in biology and it is insertable into pretty much any organism. So, yes we could make a human that would fluoresce except that human experimentation like that is rather immoral (and in most countries banned.) No self-respecting scientist would ever perform this type of experiment on another human being.

    The process is rather simple. An embryo (of any animal) is injected with the GFP gene in a carrier vector. Embryos that pick up the vector have a marker that allows them to be selected for and those embryos are then grown to maturity. Since the vector only inserts randomly in to some cells not all the cells in these adult animals will have the gene. However, statistically some of the sperm/eggs will have the gene and so when you breed out you have the chance of getting an embryo that has the GFP gene in every cell.

    Does all that make sense or did I go into too much techno-babble (a hazard of the profession.)

    I don't know why the pigs are making front page news, years ago it was done with fish (which then entered the market as a novelty item sparking a HUGE debate) and it was also done in a monkeya few years back here in the U.S.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12

    Join Date
    Mar 2005
    Location
    Canada
    Posts
    63
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I must admit it is still cool that there are now glow in the dark pigs in the world. What's next, a glow in the dark cow! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]
    I consider every plant hardy until I kill it

  5. #13
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Travis. No, your explanation wasn't too techie. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    So. What happens if two "GINTD" pigs breed? Will the trait for that be passed on to the piglets? What happens if one "GINTD" pig breeds with a regular pig? Do you get a mix of "GINTD" and regular piglets? And...what actually glows?? The skin?? Hair? Everything?

    I know when you breed a seal-point siamese and a blue-point siamese you can have seal, blue or lilac-point kittens. You get a mix...not necessarily all lilac points.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    2 GFP pigs will sire all GFP offspring. 1 GFP pig and one normal pig will either give rise to 50% GFP offspring and 50% normal offspring or 100% carrier offspring depending on the heritability trait (i.e. whether you need 1 copy of the gene for GFP fluorescence or 2 copies)

    As for what glows, since every cell has the gene then every cell produces the protein so pretty much everything glows on them. However, it is not always visable. I know on the monkey, due to his skin pigmentation, only his eyes, the tips of his hair and nailbeds would fluoresce.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    About glowing CP's: It is quite possible as a similar experiment was first done on plants years ago. I think it was with a tobacco plant, though. But it could easily be done on something else!

    Oh yeah, I made a glow-in-the-dark venus flytrap once! Just fed it a firefly and the trap glowed for an hour or more! Then it died... luminol is toxic to most plants, I think.

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    D is correct it was done with tobacco. Also with Arabidopsis and some kind of kelp I think.

    That is interesting about the firefly trap dying, I was not aware that luciferase was toxic. Glad I never ate any fireflys when I was younger.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •