User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 23 of 23

Thread: Glow in the dark pigs

  1. #17

    Join Date
    Mar 2005
    Location
    Wisconsin
    Posts
    907
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Pyro @ Jan. 18 2006,12:39)]2 GFP pigs will sire all GFP offspring. 1 GFP pig and one normal pig will either give rise to 50% GFP offspring and 50% normal offspring or 100% carrier offspring depending on the heritability trait (i.e. whether you need 1 copy of the gene for GFP fluorescence or 2 copies)

    As for what glows, since every cell has the gene then every cell produces the protein so pretty much everything glows on them. However, it is not always visable. I know on the monkey, due to his skin pigmentation, only his eyes, the tips of his hair and nailbeds would fluoresce.
    It would have to be 50/50 would it? If there was a clutch of 8 piglets, couldn't you possibly get any combination if only one copy of the GFP gene is needed? like 1 GFP pig and 9 normal, or 2 GFP and 8 normal, etc.

    Also if 2 GFP pigs gave way to offspring isn't there the chance that they pass on the other none GFP gene and give birth to normal non GFP pig(s)?
    \"Anyway, no drug, not even alcohol, causes the fundamental ills of society. If we're looking for the source of our troubles, we shouldn't test people for drugs, we should test them for stupidity, ignorance, greed and love of power.\"
    --P. J. O'Rourke
    GL

  2. #18

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lol! Yeah, it eventually killed the whole plant because some of the chemical (is it luciferase that is found in fireflies?) was absorbed with the insect. That was actually the only venus flytrap I ever tried to grow!

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Gawd_oOo @ Jan. 18 2006,2:47)]It would have to be 50/50 would it? If there was a clutch of 8 piglets, couldn't you possibly get any combination if only one copy of the GFP gene is needed? like 1 GFP pig and 9 normal, or 2 GFP and 8 normal, etc.
    Gawd,

    Actually I am wrong. If the trait is dominant then a GFP (homozygous) x non-GFP will give 100% (heterozygous) GFP offspring. If the trait is recessive then a GFP (homozygous) x non-GFP will give 0% GFP offspring.

    Quote Originally Posted by [b
    Quote[/b] ]Also if 2 GFP pigs gave way to offspring isn't there the chance that they pass on the other none GFP gene and give birth to normal non GFP pig(s)?
    Not really. Think about the breeding, to get the GFP pig you crossed mosaic siblings and got a GFP sperm fertilizing a GFP egg. Therefore the offspring are homozygous for GFP. Subsiquentially, any two GFP pigs bred together will produce GFP pigs. So unless you had a spontaneous mutation that made one/both sets of sex cells heterozygous then you should not expect non-GFP pigs from first generation GFP parents.

    However, for both situations, depending on heritability, successive generations may exhibit a different offspring profile.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20

    Join Date
    Jun 2005
    Location
    guelph
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Are you a geneticist by trade Pyro?
    "You can never underestimate the stupidity of the general public" -Scott Adams-

  5. #21
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Are the pigs otherwise normal except for the flourescent trait? This trait is not harmful to the pigs? Do they know the effects of it many generations down?

    Verrrrry interesting...
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #22
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (zac @ Jan. 18 2006,4:14)]Are you a geneticist by trade Pyro?
    In a manner of speaking I am. I am working on my Ph.D. in bacterial genetics. And since all genetic studies have their "roots" in the same place (DNA) there is a lot of cross talk between different genetic disciplines. So, while I do not do work on so called higher organisms, I still have a fair amount of knowledge on the genetic aspects for them. Plus all the years of school to get to this point have a broad range of topics and my prior work in human genetics labs

    Quote Originally Posted by [b
    Quote[/b] ]Are the pigs otherwise normal except for the flourescent trait? This trait is not harmful to the pigs? Do they know the effects of it many generations down?
    Otherwise they are normal, yes. GFP should not be harmful to the pigs, it has not proven harmful to any of the other GFP carrying organisms (ranging from bacteria and nematodes all the way up to monkeys.) Generational effects are not known for every GFP organism since not all have been breed for successive generations but in bacteria, nematodes, flies and fish at least there have not been any noted complications and we are probably into 7-10 years worth of generations for those organisms.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #23
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]Oh yeah, I made a glow-in-the-dark venus flytrap once! Just fed it a firefly and the trap glowed for an hour or more! Then it died... luminol is toxic to most plants, I think.
    Huh. That plant must not have been very strong. I've fed my flytraps several fireflies in an attempt for the coolest CP photo ever. None of my plants died.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •