User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 25

Thread: My new pup pics

  1. #17
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (indymental @ Jan. 31 2006,5:49)]That does not excuse cropping a dogs ears, it is barbaric. If your dog is one that suffers from recurring ear infections and there is no other way then maybe then, it should be considered as an option, but not all dobies will suffer from ear infections and so it is not necessary. You wouldn't have your newborn babies tonsils adenoids and appendix removed at birth because there is a possibility they will cause problems later on would you?

    I'm not trying to knock anyone who does this, I'm just trying to understand why it is necessary.
    Actually in a way it does. Like I said, I personally do not advocate the practice but there are cases where it is necessary for the good of the animal.

    Look at it this way, because of the centuries-old practice of cropping Dobie ears any genetic trait that would confer resistance to persistant ear infectins is not selected for. Because it is not selected for it therefore only occurs at a very low frequency in the population as a whole (if at all.) To totally stop the cropping technique would result in a huge upsurge in animals with persistent infection. These infections can lead to deafness, blindness, sepsis and death of the animal. And because there is no genetic trait for resistance to the infection they are particularly hard to wipe out even with modern veteranary practices. I have first hand experience with this, it took me 4 years to get the first ear infection my Dobie had eliminated. Subsequnet infections have not been as long lasting but that is because I have always been right on top on them.

    Quote Originally Posted by [b
    Quote[/b] ]If your dog is one that suffers from recurring ear infections and there is no other way then maybe then, it should be considered as an option
    I would like to address this specifically, as it is another of the common misconseptions that anti-croppers use. If you do not crop a dogs ears at an early age then you can not crop them or the will not stand up. So doing it when you learn that your dog is one that is prone to infection is not an option. Unless you want to go with the style of crop that is almost equal to total ear removal (like what you see on pit-bulls.)

    So there are cases where it is indeed necessary. Your tonsils adenoids and appendix argument is flawed because you are comparing apples to oranges. The more logical and comparable argument would be circumcision. Is it "barbaric" to circumcise a boy to prevent him from getting serious infections under the foreskin that could cripple him, render him sterile or possibly kill him?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #18
    indymental's Avatar
    Join Date
    Jan 2003
    Location
    England
    Posts
    189
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Pyro @ Feb. 01 2006,11:22)]Is it "barbaric" to circumcise a boy to prevent him from getting serious infections under the foreskin that could cripple him, render him sterile or possibly kill him?
    Actually I think it is barbaric to circumcise boys just in case of infections, fair enough if they have suffered any and are considered to be particularly prone to it, but each case should be considered seperately and not just done as a matter of course. Most times these days it is done for religious reasons and not for health reasons. So it is only a minority of boys that are circumcised anyway.

    Dobies are quite a popular dog over here in the UK and as has been said ear cropping is illegal over here as will tail docking be soon once the new animal rights laws are introduced. Any dog that has long ears or particularly hairy ears is going to be prone to infection not just Dobies, but if the owner loves their dog they will make the effort to make sure the dogs ears are kept clean, as you yourself do. I must admit until I saw this thread, ear docking is a practice I did not realised existed anywhere in the world

  3. #19
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    At one time, docking a horse's tail was fashionable. Although the docking wasn't painful for the horse, it left them indefensible against fly and bug bites which was cruel. I don't know if that has been outlawed or just not popular anymore. And I won't go into the practices that were used to achieve the gait knows as the "rack". [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  4. #20

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    so there she is! thats the one levi kept talkin about looks good!
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

  5. #21
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (indymental @ Feb. 01 2006,5:20)]Actually I think it is barbaric to circumcise boys just in case of infections, fair enough if they have suffered any and are considered to be particularly prone to it, but each case should be considered seperately and not just done as a matter of course.
    But the practice itself started as a matter of course because of the disease factor and became so wide spread for the same reason. That was my argument

    Quote Originally Posted by [b
    Quote[/b] ]Most times these days it is done for religious reasons and not for health reasons. So it is only a minority of boys that are circumcised anyway.
    Different sides of the pond, different cultures, different memes. Over here it is not a minority of boys that are circumsised, it is still fairly common practice. Nor is it mostly "religion based" over here, at the risk of getting a little too personal, I am not Jewish nor is anyone in my lineage back at least 10 generations.

    Quote Originally Posted by [b
    Quote[/b] ]Dobies are quite a popular dog over here in the UK and as has been said ear cropping is illegal over here as will tail docking be soon once the new animal rights laws are introduced. Any dog that has long ears or particularly hairy ears is going to be prone to infection not just Dobies,
    Not quite, I have had numerous other dogs in my days and all had ears comparably long to Dobie ears yet none of them were prone to ear infections. I do not know of anyone who has actually done a genetic breed study but I'd be willing to bet good money that the reason is because they are from breeds that were never cropped so they maintained the gene(s) that confer resistance to infection.

    Quote Originally Posted by [b
    Quote[/b] ]but if the owner loves their dog they will make the effort to make sure the dogs ears are kept clean, as you yourself do.
    Which is exactly why I personally do not get my dogs ears cropped. She is my dog and I love her despite the fact that she is doofy and pees on the floor as a defense mechanism LOL [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img]

    Quote Originally Posted by [b
    Quote[/b] ]I must admit until I saw this thread, ear docking is a practice I did not realised existed anywhere in the world
    Yeah, well we are all bass-ackwards here in the States so... [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #22
    indymental's Avatar
    Join Date
    Jan 2003
    Location
    England
    Posts
    189
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    lets be honest, tail docking and ear cropping are done purely for fashion. Kennel clubs like Crufts have decided that is the way a particular breed of dog should look and most owners go along with it so the puppies they sell can be considered showclass.

    Springer Spaniels and poodles having hairy ears are more prone than Dobies could ever be for getting ear infections, so why are they not routinely cropped? Because it is not the fashion to do so. I know this to be correct having spoken to a veterinary surgeon about it, who tells me Dobies are very low on the list, as dogs that suffer from bad ear infections.

    Ear cropping and tail docking are done with scissors and no pain relief, anaesthetic or local are given to the pups who are barely a few days old when it is done. All suffer a great deal of pain from the experience. Those poor Dobie pups were probably tail docked on the same day their ears were cropped, can you imagine how that must have felt?[img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_h_32.gif[/img]

  7. #23
    Jeremiah Harris's Avatar
    Join Date
    May 2002
    Location
    Colorado Springs
    Posts
    1,239
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hello,

    I don't know how much you or your veterinary surgeon know about cropping Dobie ears but it definitely never done at just a few days. They are almost always done at 10 to 16 weeks. I know my vet uses anesthetic and a technique involving lazars so there is basically no bleeding and the dog does not even notice it the next morning. It is far less dangerous of an operation the spaying or neutering but nobody has problems with that. I will admit though I did have them cropped for purely cosmetic reason I love that classic sleek look and don't think they look right without it done. I guarantee you that this dobie has the best life of any dog I have ever heard of and probably better then 50% of humans. She has slept in my bed every night since we got her and will for the rest of her life. Someone in our family is nearly always home to watch her. We take here to a leashless dog park 2 to 4 times a week. She goes for daily walks/runs and eats $35 a bag dog food. Our two beagles share 36 different collars and no two are alike, she still wears theirs but as soon as she grows out of them she will have plenty as well.

    I don't want to start a fight or anything but it always amazes me that most people could care less that over 4,000 American babies are killed each and everyday though medical procedure but as soon as someone feels an animal is being hurt they are up in arms. But to be honest I really don't think it is my place to tell someone that is wrong it is not my life.

    thanks
    -Jeremiah-

  8. #24

    Join Date
    Mar 2004
    Location
    Alabama
    Posts
    2,503
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    exactly jeremiah! Looks like you got yourself a greenhouse dog
    Join the CCPS, you wont regret it: http://s4.invisionfree.com/CCPS

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •