User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 19

Thread: Polyploid CPs?

  1. #9

    Join Date
    Feb 2006
    Location
    Indiana
    Posts
    56
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, I think we've identified Carito's fetish [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]

  2. #10
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    People use Colochine / Colquine (spelling?) on some plants, which is a dna morphing chemical. Usually they use it for pot plants to hide the distinctive leaf shape when grown outdoors. I just read something about it's use with orchids last week but I'll have to find it again.

    ...just imagine smoking something treated with that?? Maybe that's how those people above got those extra fingers? [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_n_32.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

  3. #11

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, when I said it was ridiculous, I suppose 'amazing' would have been a better choice. Anyway, I believe it, I just think it's crazy how different octoploid animals could be from their diploid predecessors after a couple of generations!

    Hey! I learned something today and I'm not even in school... like all those other times I learned something!

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If Colochine/Colquine is the same thing I am thinking of (colchicine) then it does not mutate the DNA, it actually causes the spindles to not form during mitotic divison so when the cell first divides the "duplicated" DNA is not seperated from the original and gets left in the divided cell. Depending on the concentration of colchicine there can be anywhere from 2 to 1000 duplicate copies of the DNA/cell.

    Also found this little tidbit while surfing around:

    Polyploidy is much rarer in animals. It is found in some insects, fishes, amphibians, and reptiles. Until recently, no polyploid mammal was known. However, the 23 September 1999 issue of Nature reports that a polyploid (tetraploid; 4n = 102) rat has been found in Argentina.

    And I also recalled form my intro to genetics class (some 10 odd years ago) that our own livers can have polyploid cell.

    As for someone smoking colchicine treated pot... Shold not have any major effect since it is only used on the seeds and by the time anything was harvested the colchicine would have broken down. Of course, with 2 copies of the THC gene the plants might have twice the concentration so maybe that could do something...?

    As for the octoploid and the diploid being different, really they are pretty much the same

    C. ornata the octoploid

    C. cranwelli the diploid

    The ornata are a bit larger (can eat adult rats [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] at least mine used to) and colourful and have a slightly different head/jaw structure. To most people they look like the same frog though. Heck even the armchair "professionals" and dealers get them confused because all the albino "pacman" frogs are actually cranwelli yet you often see them listed as ornata.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13

    Join Date
    Nov 2003
    Location
    Singapore
    Posts
    1,453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Harsh weather or strange environmental conditions can also cause polyploidy. My professor suggested I cool the stigma of my flowering Nepenthes to induce it to produce diploid gametes... [img]http://www.**********.com/iB_html/non-cgi/emoticons/laugh.gif[/img]

    Often, these species are much larger, have much better foliage and outstanding traits. However they grow in specific conditions, usually found near a nutrient/water/sunlight rich place etc...

    I think they can be fertile (with either parent?) or with the same type of polyploid. While in animals a single DNA mutation would already cause havoc, not to mention diploid gametes.

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Jason Wong @ Feb. 23 2006,8:24)]While in animals a single DNA mutation would already cause havoc, not to mention diploid gametes.
    Sorry, I just have to agrue with you on this point Jason (just part of my being a geneticist) I am not doing it to be mean, I just want the world to actually understand the truth and not what the media spouts out. [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img]

    Most single DNA mutations are actually totally and completely unnoticed (we in the field call them "silent") The degenerate nature of DNA is the main cause behind this though there is some small part to play in the nature of protein folding.

    If you are really interested in learning more about genetics and you can deal with storng opionioned writters than I recommend Richard Dawkins. Start with The Selfish Gene, if you like that he has a bunch of others.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    Carito's Avatar
    Join Date
    Feb 2006
    Location
    Cerritos (S. California)
    Posts
    156
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Decapod73 @ Feb. 23 2006,1:23)]Well, I think we've identified Carito's fetish [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_m_32.gif[/img]
    eee eheheh

  8. #16

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (Pyro @ Feb. 23 2006,10:08)]Most single DNA mutations are actually totally and completely unnoticed (we in the field call them "silent") The degenerate nature of DNA is the main cause behind this though there is some small part to play in the nature of protein folding.
    To elaborate on Pyro's point here (I AM NOT A GENETICIST! DO NOT BELIEVE ANYTHING I SAY UNTIL HE CONFIRMS IT!), I think most gene mutations in DNA are point mutations, meaning a single base is changed. This is one way through which we get genetic diversity. Frameshift mutations (deletion/addition) cause more problems and chromosomal mutations are the ones that can really screw you up. Once again, I could be completely wrong.

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •