User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 19

Thread: Polyploid CPs?

  1. #1

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey guys. I've been reading a little bit about polyploid organisms. Basically, it's where chemicals are used to make plants double or triple their chromosome number (it works with animals, too, but is fatal). I was thinking about doing this to plants like orchids and various CPs that are commonly grown out of tissue culture. Just add yet another hormone and get a new species! Apparently, people already do this to create new species of plants using things like citrus and banana. Any home TC'ers out their should research these chemicals and try it out.

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  2. #2
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    I'm in class so I don't have much time to respond here, but let me warm you. THESE CHEMS ARE DANGEROUS. Chemicals that cause your DNA to alter in any way are dangerous. These are carcinogens that don't play nice. More to come once I'm at home...
    \(_o)/ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  3. #3

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey, I'm in class, too! ...sort of. Sounds to me like it wouldn't be a good idea for home TCers. Well, there are still a significant number of professionals TCing CPs. Maybe some will hear about this and try it out! I bet you could get some pretty cool stuff after a couple of generations (if they weren't sterile).

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    most of the fertile hybrid drosera are polyploids. Try looking at some of the old listservs for posts by Ivan Snyder, he does a lot of work with it. I know of a number of other TCers that are using cholchisine (sp??) on seeds of things too. Does not necessarily do much most of the time. about all you can expect is gigantism or fertile hybrids.

    Also, polyploidy is not always fatal in the animal kingdom. Numerous frog species are polyploids. Two that spring to mind are grey and Cope's grey tree frogs (the former is a tetraploid of the latter) and Chacoan and ornate horned frogs (the latter of which is an octoploid of the former.) Insects too, and I think there is at least one lizard species...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5

    Join Date
    May 2004
    Location
    US
    Posts
    463
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Octoploid?! That's ridiculous! How do you get a polyploid frog?

    -D. Lybrand
    Check my growlist! Nothing currently available for trade...

  6. #6
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Why am I reminded of John Madden's 8-legged Thanksgiving turkeys?! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    Seriously, there are people who have 6 digits on each hand.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (dlybrand @ Feb. 21 2006,9:28)]Octoploid?! That's ridiculous! How do you get a polyploid frog?
    It is not ridiculous it is absolute fact. If you don't believe me then google it I am sure all the info you need is there. Try it for both the frogs I mentioned, you'll see.

    I'll even do the first step for you. If you perform a google search for "Ceratophrys ornata, octoploid" the first 2 hits you get are these 2 articles which I have copied straight off of the PubMed database:

    Rahn IM, Martinez A.

    Chromosome pairing in female and male diploid and polyploid anurans (Amphibia) from South America.
    Can J Genet Cytol. 1983 Oct;25(5):487-94.

    Abstract:

    Chromosome pairing in females and males of diploid (2n = 22) and tetraploid (2n = 44) Odontophrynus americanus and diploid Ceratophrys cranwelli (2n = 26) and tetraploid C. ornata (2n = 104) showed that diploid females formed more chiasmata per paired arm than diploid males and polyploids of both sexes. There was a reduction in the level of recombination in female polyploids by forming multivalents with terminal chiasmata. The reduction reflected a change in the genetic control of pairing in females after polyploidization

    (note that even though they say "tetraploid" in the abstract if you do the actual math it is octoploid.)

    And this one as well:

    Leipoldt M, Kellner M.

    Ribosomal RNA structure in the diploid and phylogenetically polyploid amphibian species Hyla and Odontophrynus.
    Comp Biochem Physiol B. 1984;79(2):181-5.

    Abstract:

    Ribosomal RNA of the diploid amphibian species Hyla chrysoscelis and Odontophrynus americanus is structurally modified by hidden breaks. Phylogenetically polyploid related species like the tetraploid Hyla versicolor, the tetraploid Odontophrynus americanus and the octoploid Ceratophrys ornata do not show hidden breaks in ribosomal RNA. Structural modifications of rRNA molecules in diploid amphibians has no detectable effect on the ribosomal activity in vitro.


    To get an octoploid I would guess would require a 2 step evolutionary process. First you would get a tetraploid animal, either from a failed first stage mitotic division of the embryo or from 2 diploid gametes combining. These tetraploids would then have to mate against themselves or against a normal diploid animal. In the first case you could go through the same processes above. In the second case only a diploid gamete from the diploid parent would work. At a guess, since a tetraploid intermediate has not been found I am guessing that it was not evolutionarily stable and died off leaving only the diploid and the octoploid.

    Of course that is just my radical theory since amphibian genetics is not my absolute field of study (I am bacterial geneticist [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile.gif[/img] )
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    Carito's Avatar
    Join Date
    Feb 2006
    Location
    Cerritos (S. California)
    Posts
    156
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (jimscott @ Feb. 22 2006,8:51)]Why am I reminded of John Madden's 8-legged Thanksgiving turkeys?! [img]http://www.**********.com/iB_html/non-cgi/emoticons/new/smile_k_ani_32.gif[/img]

    Seriously, there are people who have 6 digits on each hand.











Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •