User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 7 FirstFirst 1234567 LastLast
Results 17 to 24 of 52

Thread: I found this in the woods behind my house

  1. #17
    back2eight's Avatar
    Join Date
    Jan 2006
    Location
    Mississippi
    Posts
    565
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LOL, like I said, you have to live here or have lived here to understand. I am already the weird one for growing CPs and keeping poison dart frogs. I knew that there would be some who really don't understand the south chime in and say I was wrong for saying that. As much as I would like to educate people about it, it is not going to happen here. you can see their eyes glaze over when I try to talk about anything like that, and I have tried. I certainly don't need to alienate people here, I need to fit in since it is very important to my husband's ministry for us to connect with people here. They did not bring us here so we could educate them on environmental issues.

  2. #18
    back2eight's Avatar
    Join Date
    Jan 2006
    Location
    Mississippi
    Posts
    565
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

  3. #19
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Then dig them up and give them to the preserve to replant.

  4. #20
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]That's easy to say up here. That's why I mentioned the economic benefits of doing controlled burns in a Longleaf Pine forest. I spent some years in Mississippi and environmental issues seem to carry a lot of baggage there. My uncle, who was a minister with a deep interest in nature, moved to a small Mississippi town and found people had no interest in talking about a lot of what interested him in the world. I suppose he could have tried to challenge the social paradigm, but the only movement probably would have been his family moving on looking for the next job.
    More like: Easy for me to say because I'm used to being somewhat of a social pariah! Lol.

    I LOVE a good fight. Expecially when I'm right (rare, that).

    Had a tough time keeping any friends until College (when I was able to find more like-minded people). Odd how that works.

    At any rate, Nep G. is right - just draw up a quick document and have to deed holder sign it allowing you to dig them up. They're going to die out there, and that's a loss of genetic material. We're already running short on that with this genus.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #21
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I can hear those conversations: "Did ya know that the Pastor's wife has pet frogs and carnivorous plants? Better keep the kids away from her She's weird!" or "Don't eat the cookies... they're laced with insects." or "If ya don't behave, I'm going to send you over to the parsonage, where she has plants that can eat you!"

    But they can be won over... eventually. I gave a capensis to the church secretary and now I get to borrow her camera. I showed our Pastor's wife the minibogs a few weeks ago and one hre sons the butterworts and bladderworts. These things must be introduced slowly and in a positive, non-threatening light.

  6. #22
    back2eight's Avatar
    Join Date
    Jan 2006
    Location
    Mississippi
    Posts
    565
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes I agree. Jumping in and telling them they have to preserve this bog and do radical things (to them) for these plants would not work. There is one little girl who loves my VFT and always wants to stick her fingers in the traps, and now she is asking her parents for one. If I had a spare I would just give it to her, but I don't.

  7. #23
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You should see if a local conservation group might step in. Or maybe TNC or something...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #24
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How about letting NASC approach them, either to suggest a burn or to allow a rescue. Left alone, those plants are gonna die out. They are very weak as it is. At least we could save those plants from that specific locale for the future.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

Page 3 of 7 FirstFirst 1234567 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •