User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 15 of 15

Thread: Any entomologist out there

  1. #9

    Join Date
    Jun 2006
    Location
    USA
    Posts
    12
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    also known as the Thread Legged Bug


  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Coleonyx,

    Thats the guy!!

    Here are a couple of my shots. Sorry about the focus, it is hard to macro a moving target







    I have to say, the fore legs on this guy are a great argument for convergent evolution. IMHO
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Aha! It DOES have a proboscis!

    I wonder if it's related to ambush bugs or assasin bugs?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #12
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    SO its a walking stick species?

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (schloaty @ June 28 2006,9:51)]Aha! It DOES have a proboscis!
    Yes it does, my specimine was just to small and hunched up for me to see it.

    Quote Originally Posted by [b
    Quote[/b] ]I wonder if it's related to ambush bugs or assasin bugs?
    According to the stuff I found online it is in the same family: Reduviidae. Just google "Thread Legged Bug" or "Emesaya" (the species most cited is brevipennis)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]brevipennis
    A name like that could give someone a complex.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #15
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh sure PAK. Make fun of the poor little guys deficiencies!
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

Page 2 of 2 FirstFirst 12

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •