User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 15

Thread: Any entomologist out there

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I consider myself a pretty competent armchair entomologist but this weekend I found something I have never seen (be it IRL or pictures) nor even heard about. Wondering if anyone might be able to give me a name on it.

    AS I said in the topic line, I don't have any pictures I can post but the description speaks for itself:

    Small, ~2cm long. Built and looks like a walking stick except the front pair of legs are held forward of the head and articulated like those of a praying mantis. Despite this articulation the front legs are not stocky like you see in mantids, they are however "spiked" like a mantid's.

    Anyone have any guesses as to what this could be?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,

    Could be another species of mantid - can you describe the head? Could also be a baby of either a matid or a walking stick..

    Or, and I've seen these things, if it has a proboscis instead of mandibles, it could be something entirely different - don't remember what they're called at the moment....Have to check my bug books at home.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am pretty familiar with mantids and this does not look like any I have encountered. Did not look like a nymph either.

    Head was walking stick like. I'll see if I can find the bloke again, he has been around the same spot all weekend.

    No proboscus.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    did you see if it had wings, by any chance? walking sticks don't have wings, so that could help narrow it down.

    www.bugguide.net - this website might be useful.
    -Emily

  5. #5
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    -Emily

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It has wing buds (like those found on some walking sticks.)

    The photo you found is not the bloke I found. I fired off a couple pics last night, once I get them loaded I'll post them.

    Quite literally the best description I can give is that it is a walking stick in every respect except for the mantid-like front legs.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well, my guess would still be that it's some sort of mantid. the front legs that you are describing are characteristic of mantodea.

    how about this guy?
    -Emily

  8. #8

    Join Date
    Jun 2006
    Location
    USA
    Posts
    12
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •