User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 15 FirstFirst 123456789 ... LastLast
Results 33 to 40 of 117

Thread: Further proof of Evolution? 4-finned dolphin....

  1. #33

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]For every scientific explanation to disprove the existence of God there is a counter and valid explanation to prove His existence. Choose to believe what you want brother but rationally speaking we're both right on level ground to believe what we believe.
    That's because it's a mis-application of the problem: science deals *strictly* and *only* with the observable. God, as specified in the Judeo-Christian tradition, is unobservable and unknowable. Therefore one cannot use science to disprove Him.

    Science tells us how the world works. Religion is what many use to give meaning, moral guidance, and purpose to life. Science cannot disprove (or prove) God, but Religion should also stay away from trying to specify what's true of the material world.

    The two can exist in harmony.

    Quote Originally Posted by [b
    Quote[/b] ] I can see both sides of the spectrum but science really does nothing but strengthen my beliefs in God.
    While I'm not religious, the closest thing I've had to a spiritual experience was an epiphany when studying photosynthesis, a sense of awestruck wonder at the fact that the huge, multi-ton trees outside were nothing but air, light and water, run through a special chemical cycle.

    Evolution, in the purest scientific sense, says nothing about God, common descent or not. Who's to say God isn't hiding behind the scenes, orchestrating what mutation happens when and to whom?

    I don't believe in God, but not because of science. Religion really has nothing to fear from science, and can, in fact, be enriched by it.

    Quote Originally Posted by [b
    Quote[/b] ]Though this time we have an actual scholar from the field (Mokele) so I imagine it'll go much quicker this time.
    While I'm flattered by your confidence, such threads tend to drag on anyway; there are numerous ones on the science fourms I mod at (www.scienceforums.net) where, in spite of numerous people with education in the subject equal to my own, it *still* dragged on.

    Also, technically, my field is animal locomotion, but like all of biology, *everything* involves evolution at some level, and as such I've taken numerous courses as a result.

    Mokele
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

  2. #34
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (JB_OrchidGuy @ Nov. 07 2006,12:25)]I just find it hard to believe in something that has absolutely no tangible evidence, To my knowledge. If there is some that cannot be disproven then please share it with me. Just because something cannot be disproven doesn't mean it exists. It can be speculated it exists. So please point to a valid explination to prove the existance of a god. Because at the momment I am unaware of one. Science has proven everything to my knowledge so far.

    And just for the record I have never said there was or wasn't a god. Although the evidence to the fact that there isn't is mounting. I am still just sitting on the fence leaning to the side of science. Since science has evidence and religion doesn't.

    I never said we had all the answers either, but the longer the scientist pluck at it the closer they will have the explination of everything. Yet even that will not be enough, because even if the scientist do explain everything to a tee and get EVERYTHING right. Then the religion folks are still going to say well that is how God chose to start things and that is how they unfilded. Just like the scientist explained. So the debate can go on, but religion will just keep moving things back and reinterpreting the bible to put god as the initiator of things regardless.
    You claim to be agnostic but you only look one way? Show me the official science report that God doesn't exist! Science can both prove and disprove the existence of God, but one final claim can never be made through science alone.

    The Bible is clear that God created us with free will. With that free will we have the choice to believe in Him through faith or not to believe in Him. It would be contradictory for God to force upon us 100% concrete tangible proof that He exists. For we would be forced through fear to accept and obey Him. He loves us and wants us to come to Him because we truly love Him. Not because science proved His existence. A perfect analogy for this would be marriage. When we get married, we want the person we're marrying to truly and unconditionally love us, right? What kind of marriage would it be if our wives didn't really love us and only married us out of fear or oppression? It would be a fake love and that isn't the kind of love God seeks us for!
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

  3. #35
    Cardiac Nurse JB_OrchidGuy's Avatar
    Join Date
    Apr 2005
    Location
    SC
    Posts
    3,818
    Mentioned
    2 Post(s)
    Tagged
    0 Thread(s)
    LOL. Outsider you are under the misconception that I only look away from god because of science. I look away because the religion is full of hipocrits and I get better treatment from athiests or agnostics than I do from alot of Christians. Folks who use the bible cherry pick what they want to use to prove or disprove something. The bible itself is full of contridictions. Many of the faithful feel they are better than everyone else and would rather spit on you than treat you like a decent person just because you do not go to church and proclaim to believe in God. Now I am not refuring to you in particular, but that is the vide I get from alor of "religious" people. I think it is the biggest tax shelter in the states. Because whenever someone from the church would call my wife and order a pizza they are always snobby when "reminding" her they are tax exempt. So it is not just science that detures me from being a religious persson.

    I still hold to the agnostic lable, but I have a very rebelious side and will push back when a religious morality is tried to be forced uppon me. Now I am not a bad person, but I have my own morality and do not like others rights and wrongs being forced uppon me.

    Tochey(sp) Show me the official scientific report that God does exist. The bible doesn't count because it is not scientific and was written by man. I was given the excuse that if God had written it we woudln't be able to look uppon it because of some reason. Oh yeah because we were of sin and it would be holy or something like that. Blah blah. God could prove his existance. We would still have free will to love him or not, and God would know what is true and wasn't if he did exist. Since there are many people now anyways CLAIMING to love God and who go through the motions, but are bad people or imoral people according to God. Look at the preacher who just got fired from that mega-church for paying a male prostitue for sex and buying meth from him. So I don't think that excuse is a very valid one because there is alreayd a bunch of fake love for god out there.

    There is just to much evidence pointing to the worlds and life being formed by organizing chaos.
    JB
    Friend me on facebook with JB_orchidguy@yahoo.com.
    Growlist Updated 05/08/13

  4. #36
    Outsiders71's Avatar
    Join Date
    Jun 2005
    Location
    Ohio
    Posts
    1,005
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] ]
    LOL. Outsider you are under the misconception that I only look away from god because of science. I look away because the religion is full of hipocrits and I get better treatment from athiests or agnostics than I do from alot of Christians. Folks who use the bible cherry pick what they want to use to prove or disprove something.
    I'm sorry to here the bad experiences you have had with Christians. Yes there will always be hypocrites unfortunately wherever you go, even in science (Like the claim that there will be no wild fish in 50 years). All I can pray and tell you is that it would never be worth denying yourself a honest seeking of God because of the hypocrites you've encountered. In fact it could be these hypocrites are purposely trying to turn you away from God. The enemy works in every way possible to keep us away from Him.

    Quote Originally Posted by [b
    Quote[/b] ]
    The bible itself is full of contridictions.
    What have you honestly read in the Bible that is contradictory? Most of these "contradictions" were created because the user failed to analyze the context, mis-interpreted the wording or failed to research the original translations.

    Quote Originally Posted by [b
    Quote[/b] ]
    Many of the faithful feel they are better than everyone else and would rather spit on you than treat you like a decent person just because you do not go to church and proclaim to believe in God. Now I am not refuring to you in particular, but that is the vide I get from alor of "religious" people. I think it is the biggest tax shelter in the states. Because whenever someone from the church would call my wife and order a pizza they are always snobby when "reminding" her they are tax exempt. So it is not just science that detures me from being a religious persson.
    Once again I'm sorry to hear the experiences you proclaim. However I think we can both agree that the traits you are describing are not of people of true faith. In other words just more Sunday going hypocrites that return to their immoral lifestyle after service. Every true Christian knows that God exists at all times and everywhere. Not just on Sunday at a certain church. Now I'm not saying Christians are perfect, sinless, problem-less people. We have our bad days, our down times, and our bad moments (we are all human and sinners after all). However we can acknowledge our wrongs and work towards the model of our Savior because we believe this is the best possible way we can live. So have pitty on those who live fake lives and pretend, for Jesus said it is worse to know and not listen then to not know at all. It's all about love!

    Quote Originally Posted by [b
    Quote[/b] ]
    I still hold to the agnostic lable, but I have a very rebelious side and will push back when a religious morality is tried to be forced uppon me. Now I am not a bad person, but I have my own morality and do not like others rights and wrongs being forced uppon me.
    Once again this is your free will. If you want to seek God and grow with Him you will automatically take upon the yolk (values) of God. You will adopt the morality He laid out. I think a lot of your problems is the judging that is going on. I'm sorry to hear that you have been judged and questioned by Christians. I can tell you that they had good intentions, it just came out the wrong way. Truthfully speaking there really is only one who is allowed to judge (God). This correlates with the elections thread about medical procedure/gay marriage and other issues that I disagree with. I'm personally against these issues because of the yolk that I have adopted from God. However I personally don't judge or condemn people who practice or want to practice these things. Instead I love them as I love myself, which is another part of God's yolk.

    Quote Originally Posted by [b
    Quote[/b] ]
    Tochey(sp) Show me the official scientific report that God does exist.
    I really didn't mean for this to be a back and forth thing. I was just trying to prove the point.

    Quote Originally Posted by [b
    Quote[/b] ]
    The bible doesn't count because it is not scientific and was written by man.
    That is your interpretation of it. As a Christian I believe that the Bible was written by God through man with the use of the Holy Spirit.

    Quote Originally Posted by [b
    Quote[/b] ]
    I was given the excuse that if God had written it we woudln't be able to look uppon it because of some reason. Oh yeah because we were of sin and it would be holy or something like that. Blah blah. God could prove his existance. We would still have free will to love him or not, and God would know what is true and wasn't if he did exist. Since there are many people now anyways CLAIMING to love God and who go through the motions, but are bad people or imoral people according to God. Look at the preacher who just got fired from that mega-church for paying a male prostitue for sex and buying meth from him. So I don't think that excuse is a very valid one because there is alreayd a bunch of fake love for god out there.

    There is just to much evidence pointing to the worlds and life being formed by organizing chaos.
    A big piece of the puzzle your missing here is the private, personal relationship with God. You keep mentioning "religious" and "organizations". It seems to me you had a bad Catholic or some kind of other traditional experience. Yes there's fake followers of God and there's a reason there is. It's the work of the enemy and so far it has been effective against you in your life. For it has kept you away from experiencing a true intimate relationship with God.
    James 1:17

    "Every good and perfect gift is from above, coming down from the Father of the heavenly lights, who does not change like shifting shadows."

  5. #37
    Cardiac Nurse JB_OrchidGuy's Avatar
    Join Date
    Apr 2005
    Location
    SC
    Posts
    3,818
    Mentioned
    2 Post(s)
    Tagged
    0 Thread(s)
    It is true I have been baptized catholic when I was a baby, but I do not trust a catholic as far as I can through them. The whole choosing the pope in secret thing and all the secrets they hold unnerves me. I believe they are the reason for alot of this underhandedness in religion today.

    Now don't get me wrong religion is not a bad thing. Some people need the guidance because many are too stupid to live right with out it. Notice I said many. That was not dirrected an anyone in particular so please don't take it that way. The only thing is many people take it to far and try to impose it on others. I don't care that others are religous. It does not affect me one way or the other if someone is religious or not. You are correct in the fact it comes down to people judging me because I am not religious. Yet I feel I am a good person. I trust people unles given a reason not to. So you could say I follow basicly the same path as a religious person, but I don't contribute it to the same aspect. Now does this mean I don't do things that would be shunned by religion? No. I just don't consider everything to be bad that I do, but others might. I was talking with a religious coworker, one of my favorite ones to talk with, and she said what difference does it make if religion helpsmake the world a better place. But something that I failed to think of when we were talking. What about all the wars started because of religion. Anyway I am against religion because I do not feel it holds true to the way Jesus intended it to be. Since he was the one who started it. Also I do not believe he was born of imaculate conception. Ibelieve that was altered and added to the bible by the catholic preists a long time ago to gain power. I believe Jesus was a good man, but he was also the leader of a cult gone wild. IMO

    As you knwo I am still on the fence about the existance of a God. I just dont the fact that it seems like a master/slave relationship. Refuring to him as lord.

    The same coworker that I like talking to about many things also reads the bible on a regular basis here at work, and she told me there was numorous contrdictions in the bible. She was going through and doing some math computation from one of the versus and it wasn't adding up. Had something to do with someones age or something. But she said herself the bible was full of contrdictions and left alot to interpretaion. So if it is left to interpretaion then it is logical to believe that that would fuel some of the controversy as well.
    JB
    Friend me on facebook with JB_orchidguy@yahoo.com.
    Growlist Updated 05/08/13

  6. #38

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Outsiders...

    While I feel that the bible is the most atrocious work to ever slime its way across the literary table (no matter which way you look at it), it is NOT a history book. Taking a bunch of fables compiled by a small secluded group of nomads wandering in the desert 2000 years ago as fact, in light of empirical evidence is rediculous. If you want to debate people here, feel free, go ahead, whatever. But to do so, you need ACTUAL proof, not "well its in the bible, so its true, because the bible says the bible is true, so...the bible must be true". The bible isnt worthless, its a good moral tool...but just as you dont use a pizza cutter to sand a table (not saying a pizza cutter isnt a good tool with a specific purpose), you cant use the bible as evidence for anything...ever...
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  7. #39
    nepenthes_ak's Avatar
    Join Date
    Mar 2006
    Location
    Spring Feild Ohio
    Posts
    3,116
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (JB_OrchidGuy @ Nov. 06 2006,9:58)]Those indeviduals that feel they are too good to be decendant from apes or ape like creatures just irritate me. We have found the missing link that apes and humans decended from a common ancestor.
    I dont feel too good to be a decendant from apes, apes are awsome.

    IT just isnt logical to me...

  8. #40
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am not going to waste everyone's time by going over all the science arguments because Mokele has done an excellent job of that and I agree with almost everything he has said/discussed and what I disagree with is probably just semantics more than anything else.

    What I would like to point out is that religious "anti-Darwin" Christian clade seem to be totally ignorant of the fact that Pope John Paul II declared that there was no contradiction between darwinian evoltion and the existance of a God. He also blatantly described darwinian evolution as more than just a hypothesis. (And as a side note I am also glad JP2 got around to vindicating Galileo and admitted the Church's fault but that is all an aside.)

    ANd the current pope has shown no inclination to counter JP2. He has immediatly accepted that theology ought not interfere with science and at the recent annual paupal retreat the topic of discussion was creation and evolution. Discussions from the retreat suggest that the Church will affirm a form of theistic evolution, which posits the general principle that biological evolution is valid. At the same time it is likely the Church will reject the fundamental intelligent design principle.

    I think it would behove the anti-science religions community to have a better grasp of what their leaders have accepted before they go out on crusades.

    I find it refreshing that the Church accepts that it should not attempt to question the basic theory of evolution becaue it is not something that is within the realm of theology. Like wise I think scientists would be better to leave the field of theology to those that are so schooled.

    And in closing I'd like to recommend some reading material. If you are interested in evolution and a semi-layman's discussion of how humans could come from a single-celled organism I'd recommend Dawkins book 'The Ancestor's Tale' though I will warn that, while the science is very telloing, he is very anti-religion so you'll have to have a thick skin to survive some of his caustic remarks if you are religious. And for reconciliation of between creationism and evolution try Collins book 'The Language of God' which discusses the work of Theodosius Dobzhansky. Or find some of Dobzhansky's work.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 5 of 15 FirstFirst 123456789 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •