User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: Fascinating insects

  1. #1
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Joseph Clemens
    Tucson, Arizona, U S A

  2. #2
    Let's positive thinking! seedjar's Avatar
    Join Date
    Dec 2004
    Location
    Olympia, Washington
    Posts
    4,064
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Bees work in teams. :D And honeycomb is really tasty. Nice pic too.
    ~Joe
    o//~ Livin' like a bug ain't easy / My old clothes don't seem to fit me /
    I got little tiny bug feet / I don't really know what bugs eat /
    Don't want no one steppin' on me / Now I'm sympathizin' with fleas /
    Livin' like a bug ain't easy / Livin' like a bug ain't easy... o//~

  3. #3
    JMurphy97's Avatar
    Join Date
    May 2005
    Location
    Milwaukee
    Posts
    1,250
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yea honey combs is pretty good. I like the way it makes the milk when I'm done eating it.

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Did you know they just released the honey bee genome? Pretty cool
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Are the honeybees making a come-back yet? It looks like I saw more this past summer than in the past few years.

    They make tastey honey...even if it is bee spit.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    nepenthes_ak's Avatar
    Join Date
    Mar 2006
    Location
    Spring Feild Ohio
    Posts
    3,116
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It could be veiwed as spit, but its really nectar held in a stomach be for their digestive stomach, Bee's have two stomachs and the first is for holding nectar, the other is for digesting, They set nectar into a cell, and they let the water evaporate. Thats how honey is made!

    I cant wait till i get mine in the spring...

  7. #7
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Hey Joseph, have you seen any praying mantids out there (where you live)?

    I am currently keeping a female I. Oratoria and her two oothecas (egg sacs). I can't wait till they hatch.
    -Joel from Southern California


  8. #8
    nepenthes_ak's Avatar
    Join Date
    Mar 2006
    Location
    Spring Feild Ohio
    Posts
    3,116
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yea but bee's are cooler.


Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •