User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: Good Books

  1. #1
    FarmerDave's Avatar
    Join Date
    Jul 2006
    Location
    Tallahassee, FL
    Posts
    1,355
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey everybody! I was wondering if anyone else has read:
    Demon In The Freezer, by Richard Preston
    Stephen King's Desperation, by Stephen King
    or
    Any of the "His Dark Materials" trilogy, by Phillip Pullman

    If you have I would like your imput, because these are some of my favorite books and I'd like to know what other people thought of them.

  2. #2
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I read the first two of His Dark Materials...they were really good. I should read them again, it was so long ago.
    -Emily

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I read Demon in the Freezer but it has been a while
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    FarmerDave's Avatar
    Join Date
    Jul 2006
    Location
    Tallahassee, FL
    Posts
    1,355
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think that the 3rd one is the best and then the first

  5. #5
    Frakkin Toaster Cynic81's Avatar
    Join Date
    Mar 2003
    Location
    Reston, VA
    Posts
    682
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I read the Demon in the Freezer this past september, after reading both The Hot Zone and The Cobra event in Spring/Summer of 2004, respectively.

    Suffice to say, Richard Preston is a big part of why I'm going into microbiology/biodefense
    The Best Part About Being a Sociopath is Never Having to Say You're Sorry.

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Cynic,

    Speaking as a microbiologist welcome to the ranks. But also, think looooooooooooong and hard before you commit to any type of biodefense field. I had aspirations of going in to that as well but then I actually talked to a couple guys who had done it. Long story short, if you ever decide to get out of (or are "downsized" out of) the field then our job prospects are seriously crippled as the NDAs and such sort of cripple your ability to pursue other work. The guys I talked to ended up as teachers because the wording of there exit contracts basically forbid them to do any kind of research technique that they had performed while in the biodefense projects. And I am talking real basic things like PCR and cloning and such.

    So I say stick with the micro but scrap the biodefense. You'll be happier in the long run and there is still a whole heck of a lot out there to learn
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •