User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 4 1234 LastLast
Results 1 to 8 of 25

Thread: Another gator attack

  1. #1
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This is a bit funny but darned near tragic.

    http://www.local10.com/news/10424801/detail.html

  2. #2
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This is a very important lesson here. Smoke crack and get mauled by an alligator.

    Remember that next time you hit the pipe, Whitney!


    ...... The more you know *

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Man, talk about scaring one sober.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The guy was asking for trouble. Swiming nude at 4 am in a lake that had two gator attacks in the last year...I wonder if they call him "shorty" now.

  5. #5
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Quote Originally Posted by [b
    Quote[/b] ]Apgar was taken to the hospital in critical condition with an apparent broken right arm, mutilated buttocks, leg injuries and a partially amputated left arm.

    None of the deputies was injured.
    ^LOL


    Quote Originally Posted by [b
    Quote[/b] ]Late Wednesday afternoon, trappers said that they had captured the alligator that had attacked Apgar. The gator is likely to be destroyed.
    The alligator should not have to suffer because of the guy's stupidity. Imagine: A guy high on crack, comes into your home at 4AM. Will you defend yourself and your property if the guy is threatening you?? Of course! So, do you get punished? No!
    It's not the gator's fault!!!
    -Joel from Southern California


  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The sick irony here is that the guy is going to get out of the hospital, go right back to the rock and then do something really stupid and likely kill someone else.

    Should have just let the gator eat him. No reason Darwinism can not work for the human race just cause we are "intelligent"
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by [b
    Quote[/b] (joossa @ Nov. 30 2006,1:18)]
    Quote Originally Posted by [b
    Quote[/b] ]Late Wednesday afternoon, trappers said that they had captured the alligator that had attacked Apgar. The gator is likely to be destroyed.
    The alligator should not have to suffer because of the guy's stupidity. Imagine: A guy high on crack, comes into your home at 4AM. Will you defend yourself and your property if the guy is threatening you?? Of course! So, do you get punished? No!
    It's not the gator's fault!!!
    That sucks! Not the gators fault the guy was on crack and being stupid. Beyond that it is pretty funny he was naked at 4 in the morning. I thought the gator was being nice not getting the guy in the most important spot.
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  8. #8
    endparenthesis's Avatar
    Join Date
    Jun 2004
    Location
    Northern VA
    Posts
    1,262
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If only it could have been prevented somehow.

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •