User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 18

Thread: It is hypothetical question time again

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    It is hypothetical question time again

    Okay, hypothetical question (and yes I really mean hypothetical.)


    If there were a major CP exhibit what plants would you most like to see?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Metal King
    Join Date
    Jul 2004
    Location
    St.Catharines, Ontario,Canada
    Posts
    853
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BIG, fancy Neps with lots of pitchers on 'em, HUGE Cephs.... Petiolaris complex Drosera, preferably NOT dormant ones... and odd pings like P.heterophylla or P.gypsicola (if dormant, you'd need to make an arrangement of the more unusual ones in dormancy I'd figure)

    For more plain stuff, well=arranged groupings- maybe a goup of Binata complex 'dews, a whole tray of rosetted ones (so you could compare- unless there were lotsof them, the "striking" value would not be asstrong) a nice arrangement of well-grown Pings

    a BIG Drosphyllum, and a big Roridula of some type would be super-cool too
    Da Growlist

    "You don't need a license to drive a sandwich"-Spongebob Squarepants

  3. #3
    nepenthes_ak's Avatar
    Join Date
    Mar 2006
    Location
    Spring Feild Ohio
    Posts
    3,116
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    mabudon you are making me drool thinking about it!

    What inspired this "hypothetical" question?

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nothing "inspired" it, I just got to wondering while I was potting up a few things last night.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ok, it would have to be a VERY LARGE floor map of the world. There would be a fake mountain coming out of the floor in SE Asia and in S. America.

    I would have neps around the base and up the side of the SE Asia mountain - bical, truncata, merriliana, northiana, campanulata around the base, then going up the side of the mountain, various interediate then highland plants (would have to have lowii and hamamta, I think)

    N. America would have cobras and some dews along the W coast, and the E coast would have more dews, sars & VFT's in their relative geographic locations.

    Cephs would be in Australia, with tuberous dews & pymges.

    You get the picture - CP's would all be displayed in their homelands - Don't think I've forgotten about pings or utics! They'd have their place, too, with drosopyllum, byblis, genlisea.....

    How much money do you have? ;-)
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't have any money. It was just a hypothetical question.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    pingman's Avatar
    Join Date
    Jun 2006
    Location
    California
    Posts
    342
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Drosera tuberous and petiolaris group!
    Heliamphoras too!
    Peter
    Please check my website for photos:
    http://www.flickr.com/photos/minicatt/sets

  8. #8
    NECPS President Dave S.'s Avatar
    Join Date
    Jun 2003
    Location
    Northern MA
    Posts
    589
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would like to see plants that rarely make it to display shows. These can be either plants are are rare in collections or plants that need extreme enviroments (like N. villosa) which make them less common at shows.

Page 1 of 3 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •