User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: friggin Ozzy

  1. #1
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    friggin Ozzy

    I wake up early one morning to a loud knock on my door.

    i stumbles out of bed, go downstairs and answer the door.

    When opening the door, it is Ozzy, drunk, standing in the pouring rain, and asks, "Can you give me a push?"

    I answer, "No! It's 3 a.m. in the morning, and pouring down rain."

    I slam the door in the Ozzy's face, and go back to bed.

    my wife asks who it was, and I explain the situation to her.

    She immediately berates me, "Do you remember the two guys who helped us in a bad storm two months ago. You get dressed and go help that man."

    I get dressed, go out into the pouring rain. It is pitch black, I can see no one, and ask, "Are you still here?"

    Ozzy says, "yes."

    I say, "Where are you?"

    Ozzy answers, "Over here in the swing."
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LMAO!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Guess that explains who was on my daughter's swingset the other night...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That sounds like something Ozzy would do. lol Good one!
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  5. #5
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    Guess that explains who was on my daughter's swingset the other night...
    You saw me and didn't offer me a push?

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You seemed to be doing fine going up and down the slide all by yourself. Though I would have thought that going up the slide part and then face first down the stairs might hurt a little. But you sure seemed to be having fun so who am I to judge.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    SirKristoff is a poopiehead Ozzy's Avatar
    Join Date
    Jul 2001
    Location
    Greenswamp, NC
    Posts
    13,747
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    No pain no gain.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •