User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 8 12345 ... LastLast
Results 1 to 8 of 59

Thread: An Inconvienient Truth

  1. #1
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    An Inconvienient Truth

    Al Gore’s Personal Energy Use Is His Own “Inconvenient Truth”
    Gore’s home uses more than 20 times the national average

    Last night, Al Gore’s global-warming documentary, An Inconvenient Truth, collected an Oscar for best documentary feature, but the Tennessee Center for Policy Research has found that Gore deserves a gold statue for hypocrisy.

    Gore’s mansion, located in the posh Belle Meade area of Nashville, consumes more electricity every month than the average American household uses in an entire year, according to the Nashville Electric Service (NES).

    In his documentary, the former Vice President calls on Americans to conserve energy by reducing electricity consumption at home.

    The average household in America consumes 10,656 kilowatt-hours (kWh) per year, according to the Department of Energy. In 2006, Gore devoured nearly 221,000 kWh—more than 20 times the national average.

    Last August alone, Gore burned through 22,619 kWh—guzzling more than twice the electricity in one month than an average American family uses in an entire year. As a result of his energy consumption, Gore’s average monthly electric bill topped $1,359.

    Since the release of An Inconvenient Truth, Gore’s energy consumption has increased from an average of 16,200 kWh per month in 2005, to 18,400 kWh per month in 2006.

    Gore’s extravagant energy use does not stop at his electric bill. Natural gas bills for Gore’s mansion and guest house averaged $1,080 per month last year.

    “As the spokesman of choice for the global warming movement, Al Gore has to be willing to walk the walk, not just talk the talk, when it comes to home energy use,” said Tennessee Center for Policy Research President Drew Johnson.

    In total, Gore paid nearly $30,000 in combined electricity and natural gas bills for his Nashville estate in 2006
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Inconvenient Truths
    Novel science fiction on global warming.

    By Patrick J. Michaels

    Patrick J. Michaels is senior fellow in environmental studies at the Cato Institute

    This Sunday, Al Gore will probably (did) win an Academy Award for his global-warming documentary An Inconvenient Truth, a riveting work of science fiction.

    The main point of the movie is that, unless we do something very serious, very soon about carbon dioxide emissions, much of Greenland’s 630,000 cubic miles of ice is going to fall into the ocean, raising sea levels over twenty feet by the year 2100.

    Where’s the scientific support for this claim? Certainly not in the recent Policymaker’s Summary from the United Nations’ much anticipated compendium on climate change. Under the U.N. Intergovernmental Panel on Climate Change’s medium-range emission scenario for greenhouse gases, a rise in sea level of between 8 and 17 inches is predicted by 2100. Gore’s film exaggerates the rise by about 2,000 percent.

    Even 17 inches is likely to be high, because it assumes that the concentration of methane, an important greenhouse gas, is growing rapidly. Atmospheric methane concentration hasn’t changed appreciably for seven years, and Nobel Laureate Sherwood Rowland recently pronounced the IPCC’s methane emissions scenarios as “quite unlikely.”

    Nonetheless, the top end of the U.N.’s new projection is about 30-percent lower than it was in its last report in 2001. “The projections include a contribution due to increased ice flow from Greenland and Antarctica for the rates observed since 1993,” according to the IPCC, “but these flow rates could increase or decrease in the future.”

    According to satellite data published in Science in November 2005, Greenland was losing about 25 cubic miles of ice per year. Dividing that by 630,000 yields the annual percentage of ice loss, which, when multiplied by 100, shows that Greenland was shedding ice at 0.4 percent per century.

    “Was” is the operative word. In early February, Science published another paper showing that the recent acceleration of Greenland’s ice loss from its huge glaciers has suddenly reversed.

    Nowhere in the traditionally refereed scientific literature do we find any support for Gore’s hypothesis. Instead, there’s an unrefereed editorial by NASA climate firebrand James E. Hansen, in the journal Climate Change — edited by Steven Schneider, of Stanford University, who said in 1989 that scientists had to choose “the right balance between being effective and honest” about global warming — and a paper in the Proceedings of the National Academy of Sciences that was only reviewed by one person, chosen by the author, again Dr. Hansen.

    These are the sources for the notion that we have only ten years to “do” something immediately to prevent an institutionalized tsunami. And given that Gore only conceived of his movie about two years ago, the real clock must be down to eight years!

    It would be nice if my colleagues would actually level with politicians about various “solutions” for climate change. The Kyoto Protocol, if fulfilled by every signatory, would reduce global warming by 0.07 degrees Celsius per half-century. That’s too small to measure, because the earth’s temperature varies by more than that from year to year.

    The Bingaman-Domenici bill in the Senate does less than Kyoto — i.e., less than nothing — for decades, before mandating larger cuts, which themselves will have only a minor effect out past somewhere around 2075. (Imagine, as a thought experiment, if the Senate of 1925 were to dictate our energy policy for today).

    Mendacity on global warming is bipartisan. President Bush proposes that we replace 20 percent of our current gasoline consumption with ethanol over the next decade. But it’s well-known that even if we turned every kernel of American corn into ethanol, it would displace only 12 percent of our annual gasoline consumption. The effect on global warming, like Kyoto, would be too small to measure, though the U.S. would become the first nation in history to burn up its food supply to please a political mob.

    And even if we figured out how to process cellulose into ethanol efficiently, only one-third of our greenhouse gas emissions come from transportation. Even the Pollyannish 20-percent displacement of gasoline would only reduce our total emissions by 7-percent below present levels — resulting in emissions about 20-percent higher than Kyoto allows.

    And there’s other legislation out there, mandating, variously, emissions reductions of 50, 66, and 80 percent by 2050. How do we get there if we can’t even do Kyoto?

    When it comes to global warming, apparently the truth is inconvenient. And it’s not just Gore’s movie that’s fiction. It’s the rhetoric of the Congress and the chief executive, too.

    — Patrick J. Michaels is senior fellow in environmental studies at the Cato Institute and author of Meltdown: The Predictable Distortion of Global Warming by Scientists, Politicians, and the Media.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Rattler, are you actually surprised by a hypocrytical pollititian? Democrat, Republican, whatever - they're ALL lying, hypocrytical, selfish finks.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    nope doesnt surprise me in the least................................just figured it was news worthy for this board..............
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  5. #5
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro, I am glad you posted the article by Patrick J. Michaels. The conclusions that he reaches should not stop us from doing what we can to use less fossil fuels but it does show the problem was not caused by our failure to sign the Kyoto treaty, which is widley used to discredit George Busch. It does show that there is a problem and it needs to be addressed by people who are intelligent enough to evaluate the facts...not the hype.

    Also, as Rattler states, Gore is a hypocrite...a typical politician using a problem for self-enrichment.

    I saw a program on the Discovery Channel last night that reached the conclusion that "global warming" could actually be responsible for a new ice age. It is too complex to explain here but it seemed very plausible to me.

  6. #6
    Capslock's Avatar
    Join Date
    May 2003
    Location
    San Francisco, CA
    Posts
    3,088
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The use of energy by Gore's home is a false issue. Not only is it totally unconnected from the issue of Global warming, but it's grossly unfair. Gore is a former Vice President. Do other Vice Presidents live in efficiency apartments? Is that even reasonable? No.

    Also, while I think that there should be opposing views welcomed in all issues, we should be careful about accepting what any source says. This Michaels guy isn't particularly well thought of in many circles, and he takes money from the oil/energy industry to push his views. His Quarterly is industry-funded.

    "Dr. John Holdren of Harvard University told the U.S. Senate Republican Policy Committee, "Michaels is another of the handful of US climate-change contrarians... He has published little if anything of distinction in the professional literature, being noted rather for his shrill op-ed pieces and indiscriminate denunciations of virtually every finding of mainstream climate science.""
    Malo Periculosam Libertatem Quam Quietum Servitium

    My photos are copyright-free and public domain

  7. #7
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Take into account where his energy comes from and donations he makes to alternative energy etc etc.

    I'm sure his private jet doesn't help the earth though

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The only reason I posted the article was that I had just recieved it form my father. Personally I think Gore to be an idiot of the highest calibre.

    Michaels has his own issues as well. ASide from being retty weak in math I know for absolute fact that PNAS requires a minimum of three and most often five reviewers on any given article published there.

    I was tryog to get across exactly what Capslock said, opposing views. I feel that the whole of out country is entirely too polar on the issue and both sides are missing the point.

    Personally I can readily accept that there may be global climactic change but given the absolute scale of the system I do not believe we can predict one way or the other how things will go with any degree of acuracy, especially not 93 years into the future (he!!, we can not get an acurate weather report for next week for crying out loud!) I also believe that we do not have a complete enough record of global climate to necessarily know that what we are seeing is anything abnormal. The baseline is not there to make predictions off of. That is just me personally.

    And more importantly, are people so freaking stupid to think that the advancing rate of technology will not come into play in this? Who knows what we as a species will be able to accomplish in the future? When my grandmother was born 96 years ago the people of that era would have called you insane if you said that people would be walking on the moon in less than 60 years. When my father was born it would have been madness to say that every family would have an average of 2 cars or 3 televisions or a cellphone per person. When I was born the idea of a small computer was a pipedream and genetics was the stuff of cheap sci-fi. What will my daughter's wolrd be like? What marvle of technology will be common place to her? And what of my grandson? What will he do that we today would call impossible? And what of his children? If I am alive in 2100, what might they hear from me about my day and age and wonder "how could humankind have been so bloody stupid?"

    So tell me what you think impossible today and I'll send you the postcard with 'Been there, Done that' tomorrow
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 8 12345 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •