User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 27

Thread: Need source: Butterfly larvae

  1. #17

    Join Date
    Oct 2003
    Posts
    1,211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'd second the suggestion on silkmoths. You've likely done silkworms before, so why not have something with a more interesting end result?
    1 Nxventrata

    D. muscipula & D. muscipula 'Red Dragon'(barely)

    Sarracenia leucophylla(seedling)

    S. purpurea and Drosera filiformis filiformis/ intermedia seeds waiting to sprout.

    Drosera capensis

  2. #18
    RL7836's Avatar
    Join Date
    Jan 2005
    Location
    New Jersey, USA
    Posts
    3,252
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by PlantAKiss View Post
    You need a hickory horned devil. They are as big as a hotdog.
    While truly impressive, they are also supposed to be difficult. Many people struggle w/ them.

    Better subjects and still very impressive are saturnids like cecropia, polyphemus & luna. All are typically widely available (as are their foodplants - pretty important).

    Planting fennel, parsley or dill outside in a flower bed has a very high success rate for getting black swallowtails. Leaving them on the plant will let your kid(s) search for them each time they come outside - always a fun time...
    All the best,
    Ron
    You must do the thing you think you cannot do. --- Eleanor Roosevelt

    *** Growlist / Wants / Offers ***
    (with Pics)

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Seriously--Mulberry Farms: http://www.mulberryfarms.com/horn2.htm
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Ron,

    I plan on getting some of those food plants for the garden this year, as even if that fails, they're food plants for ME too.

    Incidently, my mother called me yesterday to come look at some "thing" that's on a branch outside of her house that "something is living in." If it's on her lilac tree, my bet is cecropia moth. That would be severly cool. I found one of those coccoons once up at college all those years ago. I would LOVE to do that again.

    Pyro, I did check out Mullberry farms - they have really cool stuff.

    If I can get my wife & daughter (the daughter will be easy, wife not so much) about the painted ladies & monarchs, then I will branch out.

    I may even screen in the vents & window in my greenhouse, and make it a butterfly house as well as a greenhouse. That would be awesome!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #21
    RL7836's Avatar
    Join Date
    Jan 2005
    Location
    New Jersey, USA
    Posts
    3,252
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by schloaty View Post
    I may even screen in the vents & window in my greenhouse, and make it a butterfly house as well as a greenhouse. That would be awesome!
    Not really. When your daughter finds one of her painted ladies dead in a D. binata, VFT, N. hamata or ....... well you get the picture.... she won't be happy ....

    Eastern tailed blues are a small beautiful little lep that are drawn to moist areas. I usually find them before they're too far gone - but not always (same goes for pearl crescents)
    All the best,
    Ron
    You must do the thing you think you cannot do. --- Eleanor Roosevelt

    *** Growlist / Wants / Offers ***
    (with Pics)

  6. #22

    Join Date
    Oct 2003
    Posts
    1,211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    cocoons and ova of moths are often sold on www.insectnet.com
    1 Nxventrata

    D. muscipula & D. muscipula 'Red Dragon'(barely)

    Sarracenia leucophylla(seedling)

    S. purpurea and Drosera filiformis filiformis/ intermedia seeds waiting to sprout.

    Drosera capensis

  7. #23
    i think i planted them a little too close together... ne3p's Avatar
    Join Date
    Mar 2007
    Posts
    74
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i found that the best way to get caterpillars was to grow cabbages, then to check them regularly for eggs. that way, you get nice small cabbage whites, and i have several times also ended up with orange underwings.

    if you want something more impressive, try to obtain a couple of privet hawk moths. these are stupidly easy to breed, and can simply be released once they have laid eggs. if you do get these, be careful. i let them lay all of their eggs in the tank, and ended up with around 60 caterpillars. you wouldn't believe how much privet they got through once they grew to around the length of my finger.


    the point at which you realise your friends are also nerds: you ask for a quadrant in the fourth dimension, and they say 10:00

  8. #24
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    While truly impressive, they are also supposed to be difficult. Many people struggle w/ them
    This is soely due to the fact that thus species needs soil for pupation. Without deep enough soil, the species fails. Most people who attempt that species do not know enough to provide soil so they invariably fail.
    that makes no logic

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •