User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 4 1234 LastLast
Results 1 to 8 of 27

Thread: Need source: Butterfly larvae

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Need source: Butterfly larvae

    Hey, anyone know a good source for butterfly larvae?

    I've looked around the internet, and only found two places that have anything besides painted ladies.

    Nothing against painted ladies, but I'd like a selection!

    I'd really like to rear some catterpillars with my daughter, and the bigger the better (and the more the better)....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    Hello, I must be going... Not a Number's Avatar
    Join Date
    Nov 2006
    Location
    Los Angeles, CA
    Posts
    7,506
    Mentioned
    5 Post(s)
    Tagged
    0 Thread(s)
    Search under biological supply butterfly

    Brassica
    Swallowtail chrysalids

    for example
    Grand Hotel... always the same. People come, people go. Nothing ever happens.

  3. #3
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You want to see something that your daughter will never and I mean never forget. Hatch one of the giant silkmoths, Luna and Cecropia emergence is truly amazing.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You guys rock. Thanks.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mulberry Farms offers tomato and tobacco hornworms which become interesting moths IIRC. ANd I believe they are raisable on silkworm chow. Or you can just order silkworms...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh boy Oh boy Oh boy!

    Check out what I found.....
    http://www.freebutterflyeggs.com/

    look around the sight! What a selection:

    http://butterfliesetc.com/index.php
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    rubrarubra's Avatar
    Join Date
    Dec 2001
    Location
    Ventura county, southern CA
    Posts
    330
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I could probably find you a few cabbage whites if you like those. That's what I started out on. I thought they were awesome until I started growing Brassicas. Now they usually end up as spider food.

  8. #8
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I thought Brassicas were cabbage whites.

    Anyway, I went with a milkweed plant and a plantain along with Monarch and painted lady eggs - there are only three species they sell that they're allowed to send to NY, and they were out of the third (Eastern Black Swallowtail).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •