User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 24

Thread: Warning to Atlanta area growers

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ugh. That's infuriating.

    Why must people be so selfish and inconciderate?

    Where are these plants that they're easily accessable to potential theives? Even a motion sensing light might be enough to discourage further forrays into your goods.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Do you think it is someone who knows their CPs? Or just someone who was like, "that's a cool plant... I want it!" and then stole it? How disappointing.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  3. #11
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thats BS. You think it was a night or day robbery? Or in absence of you at your house?

  4. #12
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow dude sorry! That's pretty low.

    Takes a small person to steal plant.

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My bog is on the back side of my house in my fenced yard. So not visibe from the road.

    I am not sure what to think of who it might have been. That I was struck implies someone local. But I think I know all the local growers and I have met all but 3 of them. I hate to think it was one of them but I guess it is possible...

    As for whether or not the person knew CPs. Again, only CPers would know that I have a bog and where it is which again implies someone local (or I guess passing through.) That the 'Leah' was snatched suggests to me that the person knew what it was because the plant is not right out from in the bog and after being outside all winter it looks pretty crappy. They had to go off the lable. And even that does not make much sense because if they were lable reading then how could they miss the oreos and the montana and a few other uber-rare types? Unless they are complete morons...

    When it was done is questionable. I am inclined to say recently because the leuco x umlaf was not showing signs od stress despite not being rooted in the ground. Of couse I keep the bog rather wet even in winter and there was still soil mass arounf the roots so... If it was done while we were here it would have to have been done at night because my wife is home and the dogs are out all day. It is possible it was done while we were out of town over Pres weekend but I did not tell anyone I was going out of town...

    Yet another argument for that Remmington shotgun for home defense. Definitly getting motion hookups for the lights
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14
    quogue's Avatar
    Join Date
    Aug 2006
    Location
    Long Island, NY
    Posts
    773
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That IS really low.... I would say report it to the police (even though they may give you a blank stare) so if you catch him in the future, there's a record to go by.
    Do you guys have the "Castle Laws" Cha-Chak...

  7. #15
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Start questioning the ones you don't know! Be inconspicuous about it.

    Wasn't me I live in the metro but an hour away from the ATL lol.

    I don't think the cops will do crap to be honest. Get a little motion sensing camera for next time they go back, an infrared one, too. Look for plants on sale on Ebay and people posting pics of their new Leah and see if it's the same plant.

  8. #16
    JRFxtreme's Avatar
    Join Date
    Nov 2006
    Location
    Miami, FL
    Posts
    536
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thats really screwed up. You should really report it to the police. I'm sure if you mention how expensive Leah is sold for they wouldn't take it lightly.


    Maybe the reason they left the oreos and montana alone are because they can't sell those.

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •