User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Cicada maddness

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Cicada maddness

    So, had some interesting cicada encounters recently and thought I'd share.

    First ones, found this Labor Day night while walking the dogs







    Then, while doing yard work yesterday I heard one calling in the bush next to me. Went to catch it and heard a second, low droneing buzz. Found this:





    The hornet decided he did not like being caught on film so he dropped the cicada. to get an idea of size:





    Couple hours later I saw this interaction:





    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And a solo of the mantid

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Superb, Pyro!

    Is that a Carolina Mantis?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yep...the cicadas here are deafening at times. (If you ever get one in your house, it'll split your eardrums). I am starting to find dead ones though.

    I also found a mantid in my house a few days ago. He was still around the next day so I helped him outside and then took photos. Unfortunately didn't get any reeeally good ones. He was cool though...would clean his antennae and waggle his mouth.

    Will try to post pics at some point.
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  5. #5
    Stop having a boring tuna, stop having a boring life! neon-eon's Avatar
    Join Date
    Oct 2006
    Location
    Portland Oregon
    Posts
    453
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You know, it's strange, I hear cicada's all the time, but i don't think I've ever seen one until now. As for mantids, I saw one in the wild for the first time last month while working at my nursery job... Great close up's though! despite the fact that I grow CP's I still freak out if a bug is too close to me...
    -No matter what you do with your life, I still care about you. -Mr P.

  6. #6
    Meaven's Avatar
    Join Date
    Aug 2006
    Location
    Minnesota
    Posts
    211
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i also have never seen a cicada. i grew up thinking that noise was the power lines. kinda weird.
    if i were ruler of the world, anyone who defined a nepenthene as a "companion plant" to orchids would be fired from a cannon atop mt. kinabalu.

  7. #7
    jiana54's Avatar
    Join Date
    Apr 2002
    Location
    chicago, il
    Posts
    235
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i thought they all died. there were like a million of them here in illinois in july and now they're all gone.
    Go White Sox!!

    "When the power of love overcomes the love of power, the world will know peace." -J Hendrix

  8. #8
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Beautiful shots man! Love the mantid, of course!

    My kittens caught a cicaida a few weeks ago, I mysef have never seen one in person only in books and on TV. They brought it in the house and had the best time with it, they'd dance around it, it would buzz and click eventually though they swatted it too may times. I think one of them ended up eating it.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •