User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: Why did all my feeder crickets die last night?

  1. #1
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Why did all my feeder crickets die last night?

    I woke up today to feed my baby anole and all but two tiny crickets died.
    The crickets are in a large Lee's Cricket Keeper with a dish of calcium enriched grain food and some orange slices that are supposed to be like food/water for the crickets.

    Is there any explanation for this? Is this common to have a massive die off of pinhead crickets? I only had the crickets for about 3 days (since saturday).

  2. #2
    Carnivorous plant enthusiast vraev's Avatar
    Join Date
    Aug 2006
    Location
    Ontario, Canada
    Posts
    2,806
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I remember when I went to get pin head crickets from my local petstore they said they stopped carrying them as:

    1) they grow too fast
    2) They are hard to care for

    Is 2 the case though? however, if all except 2 died...then something must be wrong in the setup. I never tried..but I would suggest googling it out for caring for pinheads (crickets! lol!).

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I use crickets to feed my mantids. They're never around long enought to die of anything besides being eaten to death - or the occasional moment when the cat sneaks in the to hot room.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You should not have that massive a die off unless something is wrong. I would try a different fruit as a water source or maybe go with a soaked cottonball. I have been able to pull pinheads up to adults before with little difficulty. Also, I am sure it is redundant to say it but just to cover all bases, did you wash the orange before cutting it up and putting it in with the crix?? Because residual pesticide could be a culprit...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Did the temperature spike or drop really fast where they were being stored?

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  6. #6
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If the orange slice had peel on it, maybe it had residual pesticides on it?

  7. #7
    Hello, I must be going... Not a Number's Avatar
    Join Date
    Nov 2006
    Location
    Los Angeles, CA
    Posts
    7,506
    Mentioned
    5 Post(s)
    Tagged
    0 Thread(s)
    I used to use slices of raw potato to feed mine. I don't know if it makes a difference.

  8. #8
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oops, I should have clarified, It's Fluker Farm's pre-packaged Orange Cube product. I don't think it's actully oranges but some kinda gelatinous mass that was cut into cubes and smells like oranges. I'll try a wet napkin or cotton ball for water in addition to the cricket gut load grain. How often do I need to replace the water/food for the crickets?

    It could have been a temp drop however, the fruit fly cultures are on the shelf just above the crickets and they're going strong producing way more than I can feed one tiny lizard.

    I got my shipment of "real" pinheads by UPS today, the ones I got from the herp shop must've been 2-3 week old (but labeled pinhead) compared to the ones I got today. These ones are about the size of D. melanogaster FFs, smaller than the D. hedyi! I'll need these to get bigger before I bother putting them in the lizard tank as he isn't paying much attention to the smaller FF anymore.

    Do crickets need a day/night light cycle? I don't have them (or the fruit flies) under any kind of lights, just on the front edge of my plant/animal bookshelves below the terrarium so they aren't in the dark all the time but they don't have any direct/specific lighting.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •