User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 13

Thread: In memory

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    In memory

    Had a bad weekend. Had to put down our Dobie, Pandora. She had cirrohsis of the liver and was not responding to the meds.



















    She was a wonderful dog. We will miss her

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    From the looks of these pictures, she put up with a lot even outside of her sickness! I love the one with her sitting in the chair She's a beautiful dog. I know how much it can hurt to let them go... But it IMHO it shows how much you cared about her to not be selfish and let her go peacefully.
    Thanks for sharing.
    Don't worry about being strong.... I say let it out. Goodbye, Pandora.
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  3. #3
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sorry man. She was a beautiful dog! Especially cute in the chair

  4. #4
    Metal King
    Join Date
    Jul 2004
    Location
    St.Catharines, Ontario,Canada
    Posts
    853
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm so sorry to hear that Bro. Thanks for sharing the pics, and I hope the doggie is in a good place- some of her hair is still in my collection, so I will make sure to take extra care of those plants
    Da Growlist

    "You don't need a license to drive a sandwich"-Spongebob Squarepants

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks guys, I appreciate it.

    Yeah the chair thing was her really interesting quirk. Ever since she was a pup she would sit in chairs/couches. Never understood why she did it but we loved it. Even had to come up with a new command (a** off) to get her to not do it on other peoples furniture.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Man, that stinks. Sorry to hear about her. She was, indeed, a beautiful dog.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Aw, no...I'm sorry. She really was pretty...and it looked like she had a sense of humor.
    -Emily

  8. #8
    Lauderdale's Avatar
    Join Date
    May 2003
    Location
    Fort Lauderdale
    Posts
    1,077
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I had a big male Dobie...St. Cloud Warlock, aka...Moose. Loved him like a brother.
    That must have been tough having to put yours down. Sorry to hear it.
    Keep the pics and look at them often.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •