User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 23

Thread: Right of Passage?

  1. #9
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The assumption that a drug can help you reach manhood is about as accurate as assuming that once you reach a certain chronological age then you automatically become a man. You will meet 40 year olds that you could never call in good conscious a man, and you will meet some of your peers who may seem to have already reached that point. Adult does not always = man. Its more of a thing of behavior that everyone reaches at their own speed. If this will make you think you are a man, it may make it so in your own mind, but only your actions will make it so in the eyes of everyone else.
    that makes no logic

  2. #10

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Drugs are stupid, and it also sounds like you're trying ot think of an excuse/justify it. If you want to do some things "your people" used to do, go kill a buffalo or a bear with a spear. Eating psychoactive cactus makes you stupid, killing a bear with a stick makes you a man (if you survive). Good luck .

    But I agree with earlier comments, you are modern as hell compared to those people. My people used to put people in the iron maiden, make beeer out of wild yeast that was teeming with bacteria and unpalatable, not bathe but once a year, etc. Its 2007 and life is good. Just because people you descended from did it doesn't make it right or give you an excuse to do the same.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  3. #11
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How does it make you any more stupid than getting wasted? If anything it's safer than getting way too wasted. And how are drugs stupid when you yourself love beer? Come on dude... Ethanol is a drug. It's a legal drug but it's still a drug.

    Saying that this custom may or may not be "right" seems a little... closed minded. It's not up to us to judge the customs of ancient people. At least when it comes to harmless things like this.

  4. #12
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Jlap, im sorry you think I just "want to get high".......... but its just something I want to do for fun.....................




    also San Pedro was used by only a few high altitude tribes in Peru and Chile.........why n the hell do you try and blow smoke up our rears? you want to get high and are looking for an excuse to justify it. re-read Igrows' post.........prolly one of the more well thought out posts on drug use ive seen in awhile...........
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You know Rattler, you keep doing that and it is going to give you a headache...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    already have one older brother showed up for the first time in 18 months.......keep forgetting how much bigger he and my baby brother are than i am......we went rounds till Dad got pissed and made us stop
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  7. #15
    wicked good plants! Presto's Avatar
    Join Date
    Oct 2005
    Location
    Boston
    Posts
    1,257
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by rattler_mt View Post
    already have one older brother showed up for the first time in 18 months.......keep forgetting how much bigger he and my baby brother are than i am......we went rounds till Dad got pissed and made us stop
    well now there's an appropriate story for a thread about growing up.

    nep ak, my feeling about this sort of thing is, as long as you don't hurt anybody, including yourself, do whatever floats your boat. But I think some very good points were made about your parents' involvement. ::applauds Igrow:: A very big part of growing up is doing things without mom and dad's help. If you really do want to do this for the right reasons, then demonstrate your maturity by waiting until you can do it by yourself, from the planning to the finances to the risk both medical and legal. I would think that not relying on them would make for a more legit and satisfying coming-of-age experience anyway.
    -Emily

  8. #16
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Eating psychoactive cactus makes you stupid, killing a bear with a stick makes you a man (if you survive). Good luck .
    Ok, I actually kinda disagree with this. Eating a psychoactive cactus doesn't make you stupid. I may make you ACT stupid for while. And one can certainly be stupid about how one goes about doing it, but the act in and of itself isn't stupid.

    Attaching a bear with a sharp stick, on the other hand, is galacticly stupid.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •