User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 10

Thread: Albino Wildlife

  1. #1
    nepenthes_ak's Avatar
    Join Date
    Mar 2006
    Location
    Spring Feild Ohio
    Posts
    3,116
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Albino Wildlife

    Who has seen Albino Wildlife?

    Ive seen an Albino Squirrel today, really cute thing (wish I had my camera).

    Ive also seen Albino Crows in Alaska. Crows or Ravens, which ever they were Are ALL over the place in Alaska, Especially Albino, I don't think they are Albino just White Feathered. I think Albinos tend to be in the mammals, not Avians.

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually most of the higher animals have albinos; birds, mammals, herps, fish...

    In the wild "white" morphs are more inclined to be leucistic than albino. The mutation it takes to make a leucistic animal requires only a single mutation while total albinism (pure white) usually requires multiple mutations. Also, something about albinism confers a somewhat more reduced fitness than leucism.

    I have seen leucistic elk and bison in the wild.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    wmgorum's Avatar
    Join Date
    Mar 2007
    Location
    Little Rock, AR
    Posts
    230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Echoing Pyro's post...

    I'm not sure about passerine type birds, but there is an "ino" mutation in psittacines (parrots).

    I used to raise lots of different color mutations of cockatiels and Indian Ringnecked Parakeets. A wild-type Indian Ringneck is green with a red beak (the species is dimorphic with the males having a black neck ring and a rose neck ring... the female doesn't have either). A lutino mutation Indian Ringneck has a change in the coloration of the feathers and the bird is yellow (males have a white and rose neck ring) with red eyes. The lutino mutation is controlled by a sexed linked gene.

    There is a different mutation in Indian Ringnecks that cause a blue colored bird with a black and white neck ring. The blue mutation is controlled by a recessive gene.

    If the aviculturalist is careful, you can have both the lutino and blue mutations visible on the bird at the same time. The result is a solid white, red eyed parrot... an albino.

    All of that to say is that you will see albinism in avian species as well as other species. Many commonly kept parrot species have a lutino / albino mutation.

    The lutino / albino mutation can cause a "weak" bird. Cockatiels who have the lutino mutation, for example, tend to be smaller and have a large bald spot on the tops of their heads (under their crests) and overall don't seem to be as "fit" as a normal-type bird or one who has another mutation. These flaws can be minimized by careful selection of the parent birds.

    Another example is albinism in humans is often paired with a significant reduction in one's ability to see. The person with albinism's eyes are more sensitive to light than a person who doesn't have albinism. I'm sure the same applies to any animal that is albino.

    There are lots of albino fish commonly seen for sale: oscars, various African cichlids, tiger barbs, Corydoras catfish, etc...

    There was a nest of leucistic American alligators found in a Louisiana swamp back in the 90's. The gators have blue eyes (not pink like an albino) and most of them are in various public aquariums around the US as I understand it.

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wm,

    Your post is an excellent example of what I was talking about. Technically both the lutino and blue mutants you refer to are forms of "albinism." One is a mutation in the gene that is predominantly responsible for the darker colours (lutino) while the other is responsible for the yellow based colours (blue.) When you combine the two mutants together you get the all white form because it lacks both pathways for colour/pigment. You see the same in most of the snake morphs out there. The amelanistic albinos are red/orange/yellow and the axanthic albinos are black/silver/grey. Combine the 2 genotypes and you get what are referred to as snow or snowball albinos; all whites.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    NICK,NICK,NICK!!!!! Indians....... likeAstone76's Avatar
    Join Date
    May 2007
    Location
    Kansas, on the plains with the tumbling tumble weeds
    Posts
    168
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    On the outdoor channel, they have played videos of albino whitetail deer in the wild. Pretty cool stuff.

    Never seen one personally though.
    Here's to the first of the of the day fellas!! To old, D.H. Lawrence!!!!

  6. #6
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    aslo not all white whitetail deer are albinos...........piebald(erratic white splotches) and white(leucistic ) is fairly common inthe wild.......theres a couple of hunting areas in Montana where they half way protect piebald whitetails.....not allowed to shoot any that are more than 50% white i believe.........why they are protected i dont know unless one of the local towns in the hunting district lobbied for it so they have some "claim to fame"
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  7. #7
    SirKristoff's Avatar
    Join Date
    Dec 2007
    Location
    Puyallup, WA United States
    Posts
    4,132
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well....
    i had an albino burmese python
    and an albino ferret! Lol
    we also had a house that we rebuilt part of, it was a wood house with issues with parting in some of the walls.
    but anyways we had an all white rose bush growing and flowering in one of the walls.

  8. #8
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I highly doubt that you saw any albino corvids in Alaska, but there are many white species of birds in that size range in the area.
    that makes no logic

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •