User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 8 of 8

Thread: Another YouTube

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Another YouTube

    This just proves that we scientists are all a bunch of nut jobs but I was laughing my head off. Maybe because I am PCRing while watching/listening to it...

    http://www.youtube.com/watch?v=x5yPkxCLads
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I loved this lmao. I can't believe it was a real commercial!

  3. #3
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    I appreceiate the sentiment but man....... they don't rock! That style puts me to sleep.

  4. #4
    RL7836's Avatar
    Join Date
    Jan 2005
    Location
    New Jersey, USA
    Posts
    3,252
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    .... & here I thought engineers & botanists were nut jobs!

    For anyone else in the other 98% who may not be familiar with PCR - here is an explanation, although you may need a 2nd link to explain this one ...
    All the best,
    Ron
    You must do the thing you think you cannot do. --- Eleanor Roosevelt

    *** Growlist / Wants / Offers ***
    (with Pics)

  5. #5
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I actually liked that. lol Very funny!

    My friend is always calling me a nerd. Maybe she's right. hehe
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  6. #6
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    "I love bumblebee bumblebee tuna...."

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You mean Bumblebee cat food??
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    LOL! "Tell 'em Charlie sent ya".

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •