User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 8 FirstFirst 123456 ... LastLast
Results 9 to 16 of 57

Thread: TC defects: The latest bugbear of CP growers?

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by MrFlyTrap2 View Post
    They're here, you're just not looking hard enough.
    I did not say I had not seen anyone just that I had not seen many who were above the level of home TC

    I know there are a number of tinkerers here. But when talking about this kind of thing I think tinkerers are more likely to see mutants because, due to their lesser experience they are more likely to make a mistake that could induce a problem. Anyone doing anything for the first time is going to make small mistakes that is part of learning. Sometimes that means they contaminate their media and other times it might mean they add just a little too much or too little of something. And in the realm of biology/genetics even micromolar errors can have big effects. Someone who has been doing it long term is much less likely to make those kind of mistakes.

    And I have posted before looking for people who are doing TC at a level higher than home kits. No one replied...


    I see your points and for the most I agree (and where I do not I can probably put it down to differing opinion on my part which makes me neither wrong nor right).

    I still think people overplay the mutation/aberrant growth = mutation card though.

    Yes, chemicals can cause multiplication and mutation but their presence does not necessarily mean they will. An example is N. rajah. This thing hyper-multiplies in normal media that lacks multiplication factors, as exemplified by Rob C.'s 20,000 plants. And in all those 20,000 plants Rob has seen all of three that are variegated. So for that trait we have a spontaneous rate of 1 in 6500. That is a lot more than 1 in 600,000 but in the grand scheme of things it really is not all that high an occurrence rate
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    OMG h8 pings MrFlyTrap2's Avatar
    Join Date
    Jan 2007
    Location
    DeKalb, IL
    Posts
    682
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    (and where I do not I can probably put it down to differing opinion on my part which makes me neither wrong nor right)
    Welp, only one way to settle that... two words. -ARM WRESTLING-. Lets go!
    My Grow List

    "It is only by studying nature that can we ever hope to defeat it."

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Alright. You and me. Right here right now.

    LOL
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    moonflower's Avatar
    Join Date
    Jun 2004
    Location
    New York
    Posts
    316
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by rattler_mt View Post
    are there occationally issues with TC plants? sure.......but the benifits FAAAAAR out weight the occational TC induced mutation

    i agree... without TC, we'd only have D. capensis collections
    "Seeds? Oh yeah... sometimes I forget they grow from those. I feel like they should hatch or something."

    ~a friend's observation of my CP's

  5. #13
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Pyro View Post
    But it is not true.

    how do you know its not true?
    the fact that you have not personally deflasked any mutations is irrelevant.

    you actually dont know how many mutations are from TC and how many are not..

    so you are just guessing too..

    I understand your point..but your point is just guesswork.
    you might be right..you might be wrong.

    all I know is that the increase in mutations came along at the same time as the increase in TC..are those facts related? maybe..maybe not.
    but it seems a lot more likely to favor the "TC causes more mutations" theory.
    if it is just a coincidence, its a big coincidence!

    unless anyone has any factual data to support either position, this discussion is pretty useless..

    Quote Originally Posted by Pyro View Post
    I know there are a number of tinkerers here. But when talking about this kind of thing I think tinkerers are more likely to see mutants because, due to their lesser experience they are more likely to make a mistake that could induce a problem. Anyone doing anything for the first time is going to make small mistakes that is part of learning.
    why does it matter who is doing the TC-ing?
    for the purposes of this discussion, the end result is still "TC equals more mutations"..
    which I thought you were arguing against?

    Scot

  6. #14

    Join Date
    Aug 2004
    Location
    Atlanta Georgia
    Posts
    273
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    JLAP,

    Its funny that you mention seed grown N. Rajah plants. While it would certainly be a good thing if seed grown rajahs became available (esp. for the anti-tc crowd), it would not matter much.

    A central platform of the anti-TC movement is that seedgrown plants are more genetically diverse, and thus "easier" in the sense that certain seed-selected clones may turn out stronger and more tolerant than what the TC wholesalers are distributing. Many anti-tc folks have the beleif that the well-known difficulty of certain nepenthes (such as aristo, hamata etc.) may just be the result of putting a weak clone into tc.

    Among Nepenthes, N.rajah is the poster child for genetic uniformity. Even if seed grown N.rajah plants were distributed someday, I doubt that a dramatically easier, or more attractive clone would surface.

  7. #15
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Which would imply that the people who TC these plants deliberately select the weakest clones to sell. OK, makes perfect sense to me .. not. Actually the opposite is true. Unless you think it's some big conspiracy, in which case I'll tell you to lock your doors so the Masons can't kidnap your children in the night.

    These plants are not difficult because the clones are weak. These plants are difficult because they grow in an area with VERY specific conditions. If you can provide those conditions, however, voila! They suddenly are not so difficult. I can only think of three plants which almost everyone has a hard time with, and that which just about everything has been tried without too much success. N. pervillei, N. madagascariensis, and N. vieillardii. It is not my opinion that these are weak clones because people HAVE grown them successfully, it may just be some underlying issue that people have had bad luck with them in general. Perhaps they require some trace element that they are not provided with. We don't really know at this point.

    Diversity is a good thing. It's VERY good! Don't get me wrong. I'd like to see the market flooded with seed grown plants. I just think it's silly to be anti-TC when you can produce an unlimited amount of identical plants (I'd like to point out now that when you buy seed grown plants, you don't always know what you'll get if it's not mature. Some people like to know EXACTLY what they will get, and that's not a bad thing whatsoever.) I think it's funny that without TC, the people who argue that TC is inferior would never have gotten to where they are now as hobbyist without it.

    TC can produce mutations. Of course it can. Mutations can arise out of seed grown material, too. The word "mutation" has a very negative connotation. Most mutations are harmless, while some are beneficial either for the plant or for the aesthetics, and in some cases, particularly seen in Dionaea, beneficial for the aesthetics (Well... to some connoisseurs) at the expense of the vigor. That said, we're still asking if TC produces MORE mutations when performed by QUALIFIED people in this area of expertise. I'm not talking about Joe Schmoe adding too much of X hormone in his kitchen, I'm talking about professionals in a real laboratory. If there are so many mutations, where ARE they? PLEASE, let me see this great multitude of mutations of almost biblical proportions (by the way the anti-TC people make it sound) and I'll humbly concede.

    One of the complaints is that some plants commercially available are just one clone. I agree. We should have more than one single clone available. This is why a small amount of seed should be collected with the proper documentation and put into TC, then the best and brightest should be selected and the rest eliminated, because the diversity found in seed is not always a good thing as some are better than others.

  8. #16

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    OMG

    I had a huge thing typed up and it disappeared.

    Anyway Scotty is right. The fact that you didn't personally deflask any abberant growth/mutations is totally irrelevant. Because you haven't seem them doesn't mean they don't exist, because they certainly do. If you say TC doesn't cause any whatsoever, or at least mass propagate defects, you're not involved enough in the nep community.

    BE's diatas and densiflora have fertility issues, and IIRC there is a mutation in the number of bracts. There are 2 different mutated ventratas running around (the one Glider had, and another "palm tree" looking one). BE's ramispina has a "hunch" in the back right under where the lid attaches that makes the plant look like garbage. Other mass produced neps have fertility issues too (think DeRoose). TC plants produce basals earlier and more often than they should (BE's rajahs), variegated plants most frequently come out of TC, overdose of auxins/cytokinins makes some horrendous growth, base analogs screw things up, and lastly...95% of TC clones are males. LOL! The ratio of males to females in the wild is about 5:1...so you're telling me the ratio of about 30:1 males to females from TC is "coincidence"? Let's get serious!

    TC also takes forever, the clone sometimes doesn't represent anywhere NEAR the species's altitudinal range (tentaculata) or natural variation (raff/amp/mirabilis/alata/I could go on), sometimes has a single clone of a species which is very difficult to grow (pervillei/madagascariensis/mapuluensis/I could go on). Someone big has oft said "I felt that one clone best represented the species". Are you kidding me? Nepenthes are dioecious, and even in a single species there is an insane amount of natural variation.

    I think TC and seed grown material should work in concert, but that can't happen until there is a responsible lab that actually selects the best clones, and keeps multiple clones of a single species. Besides MT back in the day, labs have yet to do this.

    Myths also exist in favor of TC too....like the fact that mericulturing Nepenthes isn't possible. Please! There are multiple scientific journal articles on it, and it's been possible since at least '94. Another reason people are speaking out against TC is that for years it's been shoved down everyone's throats that TC is so incredibly awesome and the answer to all of life's problems, which is certainly not the case. There are problems with it, and instead of getting defensive and angry, these labs need to listen to their customers and fix what's wrong. I love natural variation and watching things grow from seed, and especially natural variation (which will never exist in TC like it will in a batch of seed). I know they're essentially the same since it is really micropropagation in this sense, but a lab will never release 300 different clones. If you don't think there are problems caused by TC and inherent to it, you're simply not involved enough in the nep community - end of story.

    Speaking out against TC isn't a fad or a scapegoat, its just that lots of people are finally seeing the benefits of seed, and realizing that it is not hard at all (as they had been told for years). Remember when people didn't want to fertilize because they had been lied to for years that it would instantly kill their plants? Same thing (more or less). People are seeing the benefits of not listening to the lies that have been mass propagated, and are acting out on it.

    JLAP,
    Rainforest - love him or hate him, he's one of the top 10 growers in the world, and has either the biggest, or second biggest (after *******) collection in the US. Even ******* labels him as "the most innovative and controversial grower on the scene today". The guy has literally thousands of plants, of multiple clones and from seed. Nothing that comes out of his mouth is unfounded. The guy has more experience than you and I combined ever will, so dismiss what he says as "crazy" or "fanatical" is truly a joke.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

Page 2 of 8 FirstFirst 123456 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •