User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 8 FirstFirst 12345678 LastLast
Results 33 to 40 of 57

Thread: TC defects: The latest bugbear of CP growers?

  1. #33
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You've been replying without reading them?

    Anyway, it's great that there are hybrids. Now, think if those seeds had been put into tissue culture. If they had, not just the guides, or just that one "someone" would have them. We all would. Can you imagine the price these hybrids would command (and rightfully so)? If they were TC'd they'd be VERY expensive. If they were ONLY available as seed grown plants, the bar is raised EVEN HIGHER and they would cost MORE because there is LOWER quantity. Forget the price. You'd have to have CONNECTIONS to get these plants. If they were TC'd, you'd just have to have the cash.

    You just don't get it, do you? You really ignored a lot of the points I made, but then again as you said you didn't read the posts before replying in the first place.


    I've got an idea. If those reading this believe tissue culture is inferior, then don't buy clones. Donate all of your current clones to the NASC auction and rebuild your entire collection from seed and cuttings (but only cuttings from seed grown plants, of course.) Until then, you're not doing anything except complaining and going out and buying the things you claim are inferior.

  2. #34
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by JustLikeAPill View Post
    I've got an idea. If those reading this believe tissue culture is inferior, then don't buy clones. Donate all of your current clones to the NASC auction and rebuild your entire collection from seed and cuttings (but only cuttings from seed grown plants, of course.) Until then, you're not doing anything except complaining and going out and buying the things you claim are inferior.
    I think we're getting a little extremist. I don't think Pyro posted in the intention of starting a TC vs SG thread. It was more a discussion of the possible misdiagnoses of problems Nepenthes have as TC-related issues and the frequency of mutations of TCed plants. Let's not fall down that other path, as we all know where that goes from visiting other forums.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  3. #35
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You mean a 20 page debate that goes in circles? Lmao

  4. #36
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Curious thread. If you believe in evolution or if you believe in creationism, or another premise -- you should realize this; most all living things, including us humans, are composed primarily of collections of mutations. If we weren't then all life on earth would be composed of one single population of very simple and identical creatures. To me that sounds as boring as it can get. Yuck!

    --

    Mutations are caused by _______ (you can fill in the blank from an incredibly long list). TC can be a vehicle to induce more mutation than would occur in most natural habitat conditions - and it is a vehicle to keep more mutations alive until they can be observed. TC is also a way to propagate them once they come into existence. When TC is used to separate organisms, especially plants, into their individual cells, then grow those cells into complete plants, many more mutations that already exist, can then be observed and possibly continued in cultivation.

    --

    One idea I see in this thread is that "mutations" are to be rejected. This concept seems very restrictive -- I personally enjoy cultivating CP. If I eliminated all the plants in my collection that exist due to mutation, then my plant room would be empty, and so would my entire garden and my freezer, refrigerator, and larder. Nope - not gonna do that, I love my mutations. Variety IS good.
    Joseph Clemens
    Tucson, Arizona, U S A

  5. #37
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Naturally this thread would blow up after I leave work for the day. LOL

    Okay, a lot of things to address so please bear with me

    @ Scot

    the fact that you have not personally deflasked any mutations is irrelevant.
    I would argue that it is. How many of the people who are so trigger happy to jump to the "mutation = TC caused" argument have actually handled as much TC material as I have?? So, with that in mind, who is more likely to have knowledge of the frequency of TC induced aberrations, someone who has deflasked hundreds of plants, someone who had deflasked a dozen plants or someone who has never deflasked a plant?

    you actually dont know how many mutations are from TC and how many are not..
    Yes, and I said as much.

    In fact that is in large part the point I am trying to make. No one actually knows because no one has actually done any serious documentation. And yet there are large numbers of people who readily and immediately point to "TC mutant" as if it were actually known.

    so you are just guessing too..
    Granted. However, I would argue that I am more hypothesizing because my more extensive hands on experience gives me actual "data" to make an educated guess from vs. someone who has little to no hands on experience. But, yes, an educated guess is still a guess. I do not deny that.

    you might be right..you might be wrong.
    Absolutely. I never said or though other wise. Which was why I started the thread in the first place. I was/am looking for a good reason(s) why so many people will instantly jump to TC = wide spread chronic mutation...

    but it seems a lot more likely to favor the "TC causes more mutations" theory.
    if it is just a coincidence, its a big coincidence!
    Okay, perhaps there was an error in my communication up to this point which I hope to correct. I never said that TC did not cause mutations nor did I say that TC does not cause more mutations. Mutations absolutely happen (I have acknowledged that fact numerous times) and anytime you are dosing any organism with most any chemical you are going to get an increase in the rate of mutation. None of that is news to me, I work in genetics for goodness sake I readily admit that there is an increased rate of mutation in TC material, but while that rate may be unnaturally "high" when compared to what you would see in nature we are still talking about rates that are probably in the one in thousands range and not the one in tens range that is portrayed by the ready and numerous replies that get flung about.

    why does it matter who is doing the TC-ing?
    Because the TC plants that are most readily available and being distributed among growers are not coming from home hobby kit people but from more professional/experienced sources. So, if we are seeing mutations in TC plants and if those plants are coming from larger, professional/experienced sources then it makes sense to confine the parameters of the argument to those sources.

    As a grossly oversimplified analogy, if you are talking about building a bridge over the Grand Canyon do you include the guy whose only bridge building experience is throwing a 2" x"8 over the stream in his backyard?? (And I am using extreme hyperbole there so please do not take me literally.)

    for the purposes of this discussion, the end result is still "TC equals more mutations"..
    which I thought you were arguing against?
    I addressed this above but just again in brief. I am not arguing against TC causing mutation. I am just saying that I do not believe it is as common as is being portrayed by the ready way in which people will jump to label all mutations as being TC in origin.

    @ Ron

    The fact that you didn't personally deflask any abberant growth/mutations is totally irrelevant.
    Again, rehashing what I said above, I would contend that it is relevant. Granted, that is only my opinion. Some people may agree with me and some people (obviously yourself and Scot included) may disagree.

    If I may posit a question. How is it that someone who has never deflasked any material or done any TC work at all could have more knowledge of the incidence of mutations than someone who has handled hundreds (or thousands if you want to take rattler's estimation) of TC plants? If anyone can tell me how asking that question is irrelevant I will be happy to hear them out. (And I am not saying that rhetorically or sarcastically)

    Because you haven't seem them doesn't mean they don't exist, because they certainly do. If you say TC doesn't cause any whatsoever, or at least mass propagate defects, you're not involved enough in the nep community.
    Point of clarification yet again. I never said they do not exist. In point of fact I have acknowledged repeatedly that they do.

    All I am arguing is that, whenever there seems to be anything wrong with a plant, a huge number of people will immediately jump to TC as a cause as if it were a fact that TC induced problems were occurring at some phenomenally high rate (like on the order of one in ten) when in fact the rate is probably in the one in a thousand or maybe as low as one in ten thousand range (which is indeed higher than the naturally occurring rate but not nearly high enough for every bloody defect to get a finger pointed at it.) You yourself witnessed it in JMatt's thread, even after you and he both said it was a seed grown plant almost everyone else who replied that it had to be TC induced.

    you're not involved enough in the nep community.
    Also, and this probably is minor in the grand scheme of things, but I am not referring to Neps only.

    BE's diatas and densiflora have fertility issues, and IIRC there is a mutation in the number of bracts. There are 2 different mutated ventratas running around (the one Glider had, and another "palm tree" looking one). BE's ramispina has a "hunch" in the back right under where the lid attaches that makes the plant look like garbage. Other mass produced neps have fertility issues too (think DeRoose). TC plants produce basals earlier and more often than they should (BE's rajahs), variegated plants most frequently come out of TC,
    Again, I am not arguing that issues do not exist (thank you for providing more example by the way, I was not aware of some of these.) What I am arguing is that they are not as common as people are acting like they are. Your examples actually somewhat help my argument. You cite 4 specific species with 5 different problems. I do not know how many DeRoose plants there are but for argument I am just going to grab 10 and say that all 10 have issues. And I know of 6 variegated species/hybrids (there may be more, but that is what I know.) I throw out rajah because I see they hyper-production as and artifact of TC and not a defect because the plants revert to normal growth when removed form TC (it is not a persisting behavior and in the end the plant behaves as it would normally) That gives us 21 specific incidences of mutation. Each one of those incidences was a "one of" thing. About half of them are obvious total flukes that you can not trace back to being the result of a defect originating in the seed (like the variegated ones which pop up among and out of totally normal siblings of the same clone.) So, out of the thousands and thousands of plants propagated up from TC you have 21 "freaks" Even if you triple or quadruple that rate to take a massive over accounting for as yet unidentified mistakes that is not a particularly high rate.

    You know, reading over this and your later replies I think you may have answered my question. I stated earlier that the only reason we even really know about TC defects in VFTs is because they are perpetuated and distributed. We have the same thing happening here with the Neps . But, where as the VFT freakss are looked upon as novel and fun, the Nep freaks are not appreciated in any way (well... maybe the variegated ones to an extent).

    The problem is that the Nep freaks are actively being distributed, much to the distress of avid Nep growers. Those avid individuals are very vocal about their displeasure with these TC freaks and are saying so loudly. But their displeasure is not so much that the defects occurred (because they are going to occur as we have established) but that they are perpetuated and distributed. Unfortunately, in their discourse there has been a corruption of communication. They are aware that the freak is the result of a singular, low incidence occurrence that has been "xeroxed" hundreds of times over but when they speak out about "all these TC mutants" people who are less savvy of the situation get the impression that each of the mutants is the result of an independent event (i.e. a new occurrence/produce of high occurrence) rather than that same single occurrence writ large...


    Well, my question has been answered (or at least I feel it has though I am happy to hear more form those that wish to contribute) but I did want to touch on a few other things for no reason then I would like to address them

    overdose of auxins/cytokinins makes some horrendous growth, base analogs screw things up,
    Yes, I am very familiar with this. As I noted above, I work in genetics.

    and lastly...95% of TC clones are males. LOL! The ratio of males to females in the wild is about 5:1...so you're telling me the ratio of about 30:1 males to females from TC is "coincidence"?
    I am not saying you are wrong so please do not interpret it that way but, do you have any source for this information? Or is it more anecdotal? I only ask because I have never heard this data put forth before and I think it bears some following up on.

    In my admittedly limited experience, of the few plants I have had flower four have been female and only two male.

    If you don't think there are problems caused by TC and inherent to it, you're simply not involved enough in the nep community - end of story.
    I said it numerous times above but since everyone seems to keep missing my position I will repeat it again: I never said that there are not problems that arise from TC. What I said was that they are not as common as people perceive them to be. And I sincerely hope that puts and end to the story.

    I think TC and seed grown material should work in concert,
    Believe it or not I actually agree with you. (Now everyone pick your jaws up off the floor LOL)

    that can't happen until there is a responsible lab that actually selects the best clones, and keeps multiple clones of a single species. Besides MT back in the day, labs have yet to do this.
    As MrFlyTrap said to me:
    They're here, you're just not looking hard enough.
    Quite seriously, the group I work with regularly sow out as many seed of as many species as they can get their hands on and readily cull the inferior plants. They are limited by space issues so they can only keep between 8-15 lines from any given batch, which isn't superb numbers but it is better than 1-2.

    Point being, they are out there.

    Correct me if I'm wrong, but the way I read Pyro's comment was more along the lines of freak "errors" happenings to Nepenthes often times get labeled as "TC issues or chemicals." For example, JMatt's thread. Even in this thread, after it was said multiple times that it was seed grown, people were still saying TC-related issues. I do see the TC-related comments quite often in posts about Nepenthes problems
    .

    Yes X, that was what I was talking about. I am glad someone understood, I was starting to think I had lost my ability to communicate. Only thing I would say here is I would make a small amendment: freak "errors" happenings to Nepenthes too often get labeled as "TC issues or chemicals."

    Germinating seed in vitro vs. in compost have roughly the same germination rates, but germinating them in vitro takes much longer. It's normal for them to take 6 months in vitro, while I get most germination on compost in 3-5 weeks.
    I have no doubt that this is indeed what you have observed, however I think you need to amend your comment to say that (i.e. "In my experience") lest people think that you are putting out an absolute fact. The group I work with sees higher germination in vitro than compost sown seed and the time to germination is about the same under both conditions. There are so many possible variables between TC setups that I do not think that any absolutes can be put down here.

    But in this case, I think the point is that this problem may often be misdiagnosed as TC-related, but rather something environmental that gets fixed, or overcome.
    You grok well X. Or at least you see it the way I do. There is a difference between an artifact condition that resolves itself and a defect is one that is absolutely permanent in nature.

    When the lab discovers the problem, they should immediately destroy the clone, but as per my listed examples, it seems no one is responsible enough to do that at this point
    As I said above, I agree with you that inferior clones should be removed from the pool as soon as they are discovered. But it is a pretty strong accusation to say that there is no one who is responsible enough to do this. There are people out there who do cull weak clones. Just because you do not personally know them does not mean they do not exist...

    I think we're getting a little extremist. I don't think Pyro posted in the intention of starting a TC vs SG thread. It was more a discussion of the possible misdiagnoses of problems Nepenthes have as TC-related issues and the frequency of mutations of TCed plants. Let's not fall down that other path, as we all know where that goes from visiting other forums.
    Right again X. I did not and do not want a thread on the merits of TC vs. SG (but for the record, as I noted above, I think both have their place and advantages.) I was specifically looking for understanding of the over-diagnosis of TC related mutations. I think I have a grip on that now. But if people would like to reply/refute to what I have said here they are welcome.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #38
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    How is it that someone who has never deflasked any material or done any TC work at all could have more knowledge of the incidence of mutations than someone who has handled hundreds (or thousands if you want to take rattler's estimation) of TC plants?
    my guestimate on your numbers comes from the fact you have sent me near 100 individual plants either still in the flask or more normally a small or large group of plants freshly unflasked before shipping. this includes a large variety of species. granted i have a hell of a time getting these plants to acclimate to my conditions and dont have near than number surviving. but given i know i am far from the only person who receives these plants, i would find it safe to say you have unflasked a couple thousand individual plants.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  7. #39
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by CPlantaholic View Post
    I just had a quick question...
    It has seemed to me that many of the mutations that occur from imbalanced hormones in TC seem to go away after an extended period (3 or more years) of being grown in normal CP media. I think a lot of times the problem is that people see the mutation and think it will be permanent, when it could really go away after propagating it normally for a while.
    However, I'm sure there are times that the mutation lasts even when grown normally for the extended period of time. My question is: how often does it occur that the mutation remains after grown for 4+ years normally and its mutated trait is able to be passed down genetically?
    Uh, growth aberrations are not always caused by, "mutation", but as you, yourself have said, growth hormones used in TC. Hormone induced growth does not necessarily follow from "mutation", which is, by definition, change on a genetic level. If I stepped on a plant, deforming some of its vegetation, that wouldn't be a "mutation", unless the plant continued to grow additional vegetation with the same stepped on appearance, maintaining the appearance that it acquired by my stepping on it, and then its offspring also showed these same changes.
    Last edited by Joseph Clemens; 04-11-2008 at 10:00 AM.
    Joseph Clemens
    Tucson, Arizona, U S A

  8. #40

    Join Date
    Mar 2007
    Location
    Hamakua Coast,Hawaii,USA
    Posts
    1,235
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Okay let me rephrase myself;
    Now in hawaii there are lots of seed grown neps
    now the USA well the continental US there are not many seed grown neps I mean there are but not that many compared to whats in hawaii. So if they (theory) can make TC seem bad or horrendous then since they are the seed grown hub(remember I said generally many people have seed grown neps) they have something special and so they will get a good amount of business by exporting to the 48 states or directly selling .
    So thats a theorey...

Page 5 of 8 FirstFirst 12345678 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •